Kaleidagraph software version 3

The steady state measurements of single nucleotide incorporation were performed as described elsewhere^{27 (link),36 (link)}. DNA substrates were prepared by hybridizing a ³²P-5′-end-labeled 14-nucleotide primer (P14A, 5′ GTCAGACTGACGTA) and a 14-nucleotide downstream primer (DP14b, 5′ GCCGGACGACGGAG) with a phosphate on the 5′ end to a 29-mer template (T-A, 5′ CTCCGTCGTCCGGCATACGTCAGTCTGAC) to create a one-nucleotide gap substrate. Reaction mixtures (10 μl) contained 50 mM Tris, pH 7.5, 1 mM dithiothreitol, 4% (v/v) glycerol, 0.1 mg/ml bovine serum albumin, 5 mM MgCl₂, 200 nM DNA, and 3 nM enzyme (truncated catalytic domain constructs of wildtype Pol μ, Pol μ mutants, or Pol μ Δ2). The truncated catalytic domain construct was used for these reactions. Reactions were initiated by adding dTTP at one of the following concentrations 0.2, 0.5, 1.5, 5, 15, 45, 70, 100 μM. The reaction mixtures were incubated at 37 °C for 4 min. After adding an equal volume of loading dye (99% (v/v) formamide, 5 mM EDTA, 0.1% (w/v) xylene cyanol, and 0.1% (w/v) bromophenol blue), products were resolved on a 12% denaturing polyacrylamide gel and quantified by phosphor screen autoradiography. The data were fit to the Michaelis-Menten equation using nonlinear regression from KaleidaGraph software version 3.6 (Synergy Software, http://www.synergy.com.