RNAs were isolated according to the protocol of TRzol reagent (Beyotime) with minor modification. cDNA was synthesized using RT reagent kit with gDNA Eraser (Beyotime). SYBR Green Abstart PCR Mix (Sangon Biotechnology Inc.) was used to perform qPCR on Toptical 96 Real-Time PCR System. β-actin were used as endogenous controls. The detailed primer information is listed in Supplementary Table 2 .
Gdna eraser
Manufactured by Beyotime
Sourced in China
The GDNA Eraser is a laboratory equipment designed to remove genomic DNA (gDNA) from biological samples. It utilizes a proprietary enzyme-based technology to selectively degrade gDNA, leaving other biomolecules such as RNA and proteins intact. The GDNA Eraser is a versatile tool suitable for a wide range of applications in molecular biology and genomics research.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
7500 pcr system, by Thermo Fisher Scientific (2 mentions)
Beyort 2 thesis kit, by Beyotime (2 mentions)
Sybr green abstart pcr mix, by Sangon (1 mentions)
Sybr green qpcr mix, by Toyobo (1 mentions)
Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Beyort 2 cdna synthesis kit, by Beyotime (1 mentions)
T100 thermal cycler, by Bio-Rad (1 mentions)
5 protocols using gdna eraser
1
RNA Isolation and qPCR Analysis
2
Quantitative Analysis of Development-Related Genes in A. pernyi
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First-strand cDNAs of the samples were synthesized at each time point using the BeyoRT II cDNA Synthesis Kit with the gDNA Eraser (Beyotime, China). qRT-PCR was performed with an SYBR Green qPCR Mix (Toyobo, Japan) using an ABI 7500 Fast Real-Time PCR System (Applied Biosystems, United States) to detect the relative expression levels of the genes related to adult development. The qRT-PCR conditions were described in Lei et al. (Lei et al., 2021 (link)). Each assay was performed in triplicate. The glyceraldehyde 3-phosphate dehydrogenase gene (GAPDH) in A. pernyi was used as the control (Lei et al., 2021 (link)). Supplementary Table S1 lists all of the primers used for qRT-PCR.
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Thermo Fisher Scientific) was adopted for extracting total tissue and cellular RNA. The BeyoRT™ II thesis kit was used in combination with the gDNA Eraser (Beyotime Bio Inc) for the synthesis of cDNA through the reverse transcription of 1 µg RNA. Then, the 7500 PCR system (Thermo Fisher Scientific) was adopted for qRT‐PCR analysis and the procedure was completed under the following conditions: 5 min under 95°C; followed by 10 s under 95°C and 35 s under 60°C for 40 cycles (Takara Bio). The primer sequences used were shown in Table 3 . GAPDH served as the endogenous reference and the IBSP mRNA level was determined by 2−△△Ct. Each experiment was conducted three times.
4
Quantitative Analysis of Osteogenesis Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time reverse-transcriptase polymerase chain reaction (qRT-PCR) was used to analyze the expression of osteogenesis-related genes on the surface of the two groups of specimens quantitatively. Each specimen was first inoculated with 1 mL of cell suspensions at a density of 5×104 cells per well and co-cultured for 7 and 14 days. We extracted total RNA with TRIZOL reagent (Invitrogen) on days 7 and 14 and detected the purity of RNA by UV-vis spectrophotometer. We then reverse transcribed the complementary DNA (cDNA) from 1 μg of total RNA using a T100 Thermal Cycler (BIO-RAD, USA) with BeyoRT Ⅱ cDNA reagent containing gDNA Eraser (Beyotime Biotechnology, China). The primer sequences of the selected osteogenesis-related genes and the house-keeping gene are shown in Table 1 . Finally, the expressions of the osteogenesis-related genes, including ALP, Runt-associated transcription factor 2 (RUNX2), type I collagen α1 (Col1α1), and osteocalcin (OCN), were analyzed using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the house-keeping gene for normalization and quantified by qRT-PCR according to their Ct (cycle threshold) values.
5
Quantitative Analysis of Gene Expression in Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tissues were stored in a refrigerator at −80°C before use. Cells and tissues total RNA were extracted by Trizol reagent (Thermo Fisher Scientific, USA). Reverse transcription of 1 µg of RNA using the BeyoRT™ II thesis kit with gDNA Eraser (Beyotime Bio Inc, China). By using a 7500 PCR system (Thermo Fisher Scientific, USA), mRNA expression was detected. The Real-time quantitative PCR conditions were as follows: 95°C, 5 min; 95°C, 10 s, and at 65°C, 35 s were cycled 40 times. To verify the specificity of the PCR products, a melting curve was performed at the end of the amplification cycle. The result was analyzed by using 2−ΔΔCt methods. All primes used are shown in Table 5 . The expression of BGN, COL11A1, and PLK1 was normalized by the housekeeping gene GAPHD.
Primer Sequences Used for Real-Time PCR
| Gene | Sequence |
|---|---|
| GAPDH-F | GAGTCAACGGATTTGGTCGT |
| GAPDH-R | TTGATTTTGGAGGGATCTCG |
| BGN-F | GGTCTGAAGTCTGTGCCCAA |
| BGN-R | GAGCTCGGAGATGTCGTTGT |
| COL11A1-F | GCTGACGGGAAGTGGCA |
| COL11A1-R | TCTATCAAGTGGTTTCGTGGTTT |
| PLK-1-F | GCTTTGCCAAGTGCTTCGAG |
| PLK-1-R | AATCCTACGACGTGCTGGTG |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!