Hep3B cells in exponential phase were prepared and transfected with shRNA suppressing Anillin through pGU6/Neo vectors (GenePharma, Shanghai, China) along with the construction of the control ones. Transfected cells were selected using medium mixed with G418 (Santa Cruz Biotechnology, Inc; 400 μg/ml). Hep3B cells over-expressing miR-138 (Hep3B/miR-138) was constructed through the mimic method similar to the description in our previous study, and the negative control were set as NigmiR. The lentiviral vector pWPXL (Addgene, Cambridge, USA) was introduced (pWPXL-SOX4) for upregulating SOX4 in cells or reversing the SOX4 abrogation induced by over-expressing miR-138, and the negative control were set as pWPXL-Null. Similar method in using lentivirus was applied in re-introducing Anillin into Hep3B cells.
Pwpxl
Manufactured by Addgene
Sourced in United States
The PWPXL is a lab equipment product. It is designed to perform a core function, but a detailed description cannot be provided while maintaining an unbiased and factual approach. No further interpretation or extrapolation on the intended use of the product can be made.
Automatically generated - may contain errors
Lab products found in correlation
Pmd2 g, by Addgene (17 mentions)
Pspax2, by Addgene (14 mentions)
Polybrene, by Merck Group (8 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (7 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions)
Pgl3 enhancer vector, by Promega (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Pcmvr8, by Addgene (2 mentions)
Plvthm, by Addgene (2 mentions)
Lipofectaminetm ltx reagent, by Thermo Fisher Scientific (2 mentions)
Pgu6 neo vectors, by GenePharma (2 mentions)
Dulbecco s modified eagle s medium dmem high glucose, by Merck Group (2 mentions)
Pspax, by Addgene (2 mentions)
Glutamax, by Thermo Fisher Scientific (2 mentions)
Purogreen, by Addgene (1 mentions)
Random primer, by Takara Bio (1 mentions)
Carboxyatractyloside, by Merck Group (1 mentions)
Digitonin, by Merck Group (1 mentions)
Cox 4, by Cell Signaling Technology (1 mentions)
Fk506, by Merck Group (1 mentions)
37 protocols using pwpxl
1
Modulating Anillin and SOX4 in Hep3B Cells
2
Lentiviral Overexpression of LZTFL1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The LZTFL1 ORF sequence was amplified by PCR using specific primers and cloned into the lentiviral expression vector pWPXL (Addgene) to develop a pWPXL-LZTFL1 recombinant plasmid. Virus packaging was performed by the co-transfection of pWPXL-LZTFL1, packaging plasmid pSPAX2 (Addgene) and envelope plasmid pMD2.G (Addgene) using Lipofectamine 3000 (Invitrogen, USA) in HEK 293T cells. Viruses were harvested 48 hrs after transfection, and viral titers were determined. HepG2 and Huh7 were infected with either recombinant lentivirus constitutively expressing LZTFL1, or control empty vector. After 24 hrs of transfection, the transfectants with control empty vector and LZTFL1 expression vector were sorted by MoFlo XDP (Beckman, USA) based on the expression of green fluorescent protein (GFP).
3
Targeting AKR1B10P1 and SOX4 in Hep3B
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hep3B cells in exponential phase were prepared and transfected with shRNA suppressing AKR1B10P1 transcript through pGU6/Neo vectors (GenePharma, Shanghai, China) along with the construction of the control cells. Transfected cells were selected using a medium mixed with G418 (Santa Cruz Biotechnology, Inc; 400 μg/ml). The lentiviral vector pWPXL (Addgene, Cambridge, USA) was introduced for ectopic expressing SOX4 (pWPXL‐SOX4) to rescue the phenotype induced by AKR1B10P1 depletion, and the pWPXL‐Null was used as negative control. Hep3B cells overexpressing miR‐138 (Hep3B/miR‐138) were constructed through the mimic method similar to the description in our previous study, followed by dual‐luciferase reporter assay, respectively, in pWPXL‐SOX4 or pWPXL‐Null‐treated cells, and the negative control ones were set (NigmiR). Relative methods were referred to the literatures of Wang, et al17 and Lin, et al.18 Additionally, we conducted the same treatment on HepG2 cells and carried out related experiments in vitro, presented in Figure S5.
4
Lentiviral Production of SF-iGluSnFR.S72A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pAAV.hSynapsin.SF-iGluSnFR.S72A was obtained from Addgene (RRID:Addgene_106176 ). The coding sequence of SF-iGluSnFR.S72A was cloned into pWPXL (RRID:Addgene_12257 ) by replacing EGFP using BamHI and NdeI. For lentivirus production, HEK 293T cells were transfected using calcium phosphate following methods described by Didier Trono (http://tronolab.epfl.ch/lentivectors ) with pMD2.G (RRID:Addgene_12259 ), pCMVR8.74 (RRID:Addgene_22036 ), and pWPXL containing SF-iGluSnFR.S72A. Two days later, culture medium containing lentiviral particles was collected in 3 rounds at 8 h intervals, kept at 4°C, and centrifuged at 500 × g. Supernatants were distributed in aliquots and stored at −80°C.
5
Overexpression of CD44s in MHCC-97L cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CD44s ORF sequence was PCR amplified using specific primers (forward: 5′‐ ATGGACAAGTTTTGGTGGCAC‐3′; reverse: 5′‐TTACACCCCAATCTTCATGTCC‐3′) and cloned into the lentiviral expression vector pWPXL (Addgene, Cambridge, MA, USA) by replacing the GFP fragment. Viral packaging was carried out in HEK‐293T cells after cotransfection of the pWPXL‐CD44s vector with the packaging plasmid psPAX2 and envelope plasmid pMD2.G (Addgene) using Lipofectamine 2000 (Invitrogen). The viruses were harvested 72 hours after transfection, and the viral titers were determined. MHCC‐97L cells were infected with 1 × 106 recombinant lentivirus‐transducing units in the presence of 6 μg/mL polybrene (Sigma).
6
Construction and Packaging of SyGCaMP6f Lentivirus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The synaptophysin::GCaMP6f (SyGCaMP6f) construct was provided by Dr. Leon Lagnado as an improved version of syGCaMP252 (link),53 (link). The coding sequence of SyGCaMP6f was cloned into pWPXL (Addgene plasmid # 12257; http://n2t.net/addgene:12257 ; RRID:Addgene_12257) by replacing EGFP using BamHI and NdeI. For lentivirus production, HEK 293T cells were transfected by the calcium phosphate technique following methods described by Didier Trono (http://tronolab.epfl.ch/lentivectors ) with pMD2G (Addgene plasmid # 12259; http://n2t.net/addgene:12259 ; RRID:Addgene_12259), pCMVR8.74 (Addgene plasmid # 22036; http://n2t.net/addgene:22036 ; RRID:Addgene_22036), and pWPXL. Two days later, culture medium containing lentiviral particles was collected in three rounds at 8 h intervals, kept at 4 °C, and centrifuged at 500×g. Supernatants were distributed in aliquots and stored at −80 °C.
7
Generating Stable PGC-1α Overexpressing Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Conducted using standard techniques. pcDNA3.1‐PGC1a cDNA (D. Kelly, WUSTL) was subcloned into lentiviral transfer vector pWPXL (Addgene), and 3T3‐L1 cells stably overexpressing PGC‐1a were generated by pWPXL‐PGC‐1a viral delivery. Clonal cell lines were isolated and assessed by PGC‐1a expression, and the same vector clonal line and PGC‐OE clonal line were used for all experiments. Metabolic phenotypes of PGC‐OE were validated in an independent fibroblast cell line (Figure S6 ). Cells used in experiments were plated for overnight growth from log phase growth, unless otherwise indicated. Immunofluorescence images were analyzed using ImageJ (NIH, Wayne Rasband, http://rsb.info.nih.gov/ij/ ).
8
Generating Lentiviral Transduced Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length human CD19 (NM_001178098.2) and CD22 (NM_001185099.2) cDNAs were first cloned into the lentiviral vector pWPXL (catalog no. 12257, Addgene). HEK293T cells were then transfected with the plasmid mixture of the lentiviral transfer and packaging vectors, psPAX2 (catalog no. 12260, Addgene) and pMD2. G (catalog no. 12259, Addgene), using polyethylenimine (MW 40,000, catalog no. 24765-2, Polysciences) following the manufacturer's instructions. Lentivirus-containing supernatants were harvested 48 to 72 hours after transfection. HeLa cells were then transduced with these lentiviruses, and CD19, CD22, or CD19/CD22 double positive cells (HeLa-CD19, HeLa-CD22, and HeLa-CD19/CD22 cells, respectively) were enriched by cell sorting using a cell sorter (S3e Cell Sorter, Bio-Rad) after staining with anti-CD19-PE (catalog no. 340364, BD Biosciences) and/or anti-CD22-PE (catalog no. 562859, BD Biosciences). Nalm6 cells stably expressing a fusion protein of eGFP (sequence from pcDNA3-eGFP, catalog no. 13031, Addgene) and firefly luciferase (XM_031473197.1) was engineered (Nalm6-eGFPLuc) by cloning the cDNAs of both genes into the lentiviral vector pWPXL. Lentiviruses were produced as described above. Nalm6 cells stably expressing eGFP and firefly luciferase (Nalm6-eGFPLuc) were obtained by lentivirus transduction, followed by cell sorting using eGFP as a fluorescent marker.
9
Lentiviral-Mediated Ectopic Hsp27 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Hsp27 ORF sequence (NM_001540.3) was PCR amplified using specific primers and cloned into the lentiviral expression vector pWPXL (Addgene). The specific shRNA sequences of Hsp27 were cloned into the vector PuroGreen (Addgene). Viral packaging was performed by cotransfection of pWPXL, pWPXL-Hsp27, shHsp27#1 or shHsp27#2 with packaging plasmid using Lipofectamine 2000 (Invitrogen) in HEK 293T cells. Viruses were harvested at 48h after transfection, and viral titers were determined. SK-Hep1, SMMC7721, MHCC97H, and HCCLM3 cells were infected with 1 × 106 recombinant lentivirus-transducing units in the presence of 6 μg/ml polybrene (Sigma).
10
Mitochondrial function analysis protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The materials used were as follows: lipofectamine™ 2000 transfection reagent (Life Technologies, Grand Island, NY, USA), lentivirus vector pWPXL (from Addgene, Cambridge, MA, USA), protease inhibitors (Cat#: 04693116001; Roche Molecular Biochemicals, Indianapolis, IN, USA), 9E10 mAb (anti‐c‐myc; ab32; Abcam, USA), M2 mAb (anti‐flag; F1804; Sigma‐Aldrich), anti‐ANT1 mAb (ab110322; Abcam, Cambridge, MA, USA), anti‐SOD2 mAb (12656‐RP02; Sino Biological, Beijing, China), BCL‐2 (BS1511; Bioworld Technology, Nanjing, China), Cyt c (AC909; Beyotime, Guangzhou China), COX IV (4850; Cell Signaling Technology, Beverly, MA, USA), anti‐β‐actin mAb (AC‐15; Sigma‐Aldrich), TaqMan Copy Number Reference Assay (4403316; Life Technologies), FK506 (F4679; Sigma‐Aldrich), actinomycin D (A9415; Sigma‐Aldrich), DNAseI (2270A; Takara), CHX (S1560; Beyotime), digitonin (D141; Sigma‐Aldrich), random primer (3801; Takara), Magnesium Green (M‐3733; Life Technologies); carboxyatractyloside (C4992; Sigma‐Aldrich), calcein‐AM (17783; Sigma‐Aldrich), CoCl2 (V900021; Sigma‐Aldrich), ionomycin (S1672; Beyotime), Bongkrekic acid (1820‐100; Biovision, Milpitas, CA, USA), Calcium green‐5N (c‐3737; Life Technologies), and DAPI (D9542; Sigma‐Aldrich); Roche‐In Situ Cell Death Detection Kit (12156792910; Roche Molecular Biochemicals).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!