Aurka sirnas

The target sequences of AURKA siRNAs (GenePharma) were as follows: 1, 5′-ATGCCCTGTCTTACTGTCA-3′; 2, 5′-GGCAACCAGTGTACCTCAT-3′; and 3, 5′-ATTCTTCCCAGCGCGTTCC-3′. The target sequence of hnRNP K siRNA (GenePharma) was 5′-AATATTAAGGCTCTCCGTACA-3′ and the negative control siRNA sequence was 5′-TTCTCCGAACGTGTCACGT-3′. The shAURKA (TRC number: TRCN0000000655) and sh control (SHC002) plasmids were purchased from Sigma-Aldrich. The shRNA sequences against hnRNP K (sense: 5′-CGCGTCCCCGTTATTGTTGGTGGTTTAATTCAAGAGATTAAACCACCAACAATAACTTTTTGGAAAT-3′ and antisense: 5′-CGATTTCCAAAAAGTTATTGTTGGTGGTTTAATCTCTTGAATTAAACCACCAACAATAACGGGGA-3′) were cloned into pLVTHM (Addgene).

The siRNA transfections were conducted with the lipofectamine 3000 (Thermofishier scientific) according to the manufacturer’s instructions. The target sequences of AURKA siRNAs (GenePharma) were as follows: 1, 5′-GCACAAUUCUCGUGGCUACUUUCACUU-3′; 2, 5′-CUCUAUAAACUGUUCCAAGUGGUGCAU-3′. The SOCS2-AS1 sequence was cloned into the lentiviral vector PGLV3/H1 (GenePharma) for stable expression in EC cells. The shRNA sequences against SOCS2-AS1 (1, GGACTTCTCAATACAGGAGCC; 2, AGAACAAAGGCAACAGAGAAG; 3, CCTGACACCTCACTCTAAATC) were cloned into PGLV2/H1(GenePharma). The shRNA sequences against AURKA (1, GGACCTGTTAAGGCTACAGCT; 2, ACCTGTAAATAGTGGCCAGGC) were cloned into PGLV3/H1 (GenePharma). Stable cell lines were generated through transduction with packaged lentivirus. Transduced cells were selected for stably infected cells with puromycin (1 μg/ml).

The target sequences of SIX3 siRNAs (GenePharma) were as follows: (1) 5′-GCCAAACTTCGCCGATTCT-3′ and (2) 5′-ATCCTTGAGAACCACAAGT-3′. The target sequences of AURKA siRNAs (GenePharma) were as follows: (1) 5′-GGGTTTGTTGTCAACCAAT-3′ and (2) 5′-ATGCCCTGTCTTACTGTCA-3′. The target sequences of AURKB siRNAs (GenePharma) were as follows: 5′-ACATCCTGCGTCTCTACAA-3′ and 5′-GGAGGATCTACTTGATTCT-3′. The negative control siRNA sequence was 5′UUCUCCGAACGUGUCACGUTT-3′.