Total RNA was extracted from 140 µL aliquots of different samples containing 17DD yellow fever virus: human sera from vaccinated patients, human serum from healthy individual spiked with purified 17DD virus, and supernatant from propagated 17DD virus in cell culture or bioreactor. The protocol was carried out using QIAamp® Viral RNA Mini kit, Qiagen (Catalog number 52906) according to the manufacturer's instructions and the RNA was eluted with 60 µL of elution (AE) buffer. Human serum of healthy individual was used as negative control. Reverse transcription reaction was performed with random primers in 20 µL of extracted RNA added to 20 µL of High-Capacity cDNA Reverse Transcription mix, Applied Biosystems (Catalog number 4368814). The obtained cDNA was stored at − 80° C until use.
High capacity cdna reverse transcription mix
Manufactured by Thermo Fisher Scientific
Sourced in United States
The High-Capacity cDNA Reverse Transcription mix is a reagent designed for the conversion of RNA into complementary DNA (cDNA). It facilitates the reverse transcription process, enabling the synthesis of cDNA from RNA templates.
Automatically generated - may contain errors
Lab products found in correlation
Qiaamp viral rna mini kit, by Qiagen (2 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (2 mentions)
Tempus spin rna isolation kit, by Thermo Fisher Scientific (2 mentions)
Tempus blood rna tube, by Thermo Fisher Scientific (2 mentions)
Gentra puregene blood core kit b, by Qiagen (2 mentions)
Triton x 100, by Merck Group (2 mentions)
Aria 2, by BD (2 mentions)
Anti il10ra clone 1b1.3a, by BioXCell (2 mentions)
Abi prism 7500, by Thermo Fisher Scientific (1 mentions)
Topo ta cloning vector, by Thermo Fisher Scientific (1 mentions)
6 protocols using high capacity cdna reverse transcription mix
1
Extraction and Reverse Transcription of 17DD Yellow Fever Virus RNA
2
Quantitative RT-PCR for Yellow Fever Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA of Human serum samples from vaccinated patients with Yellow Fever vaccine was extracted using QIAamp® Viral RNA Mini kit (QIAGEN®) according to the manufacturer’s recommendations. Reverse transcription reaction was performed with random primers (F: 5′GCACGGATGTAACAGACTGAAGA3′ and R: 5′CCAGGCCGAACCTGTCAT 3′) in 20 μL of the extracted RNA added to 20 μL of High-Capacity cDNA Reverse Transcription mix (Applied Biosystems®). The qRT-PCR assays were performed in the ABIPrism 7500 (Applied Biosystems®) using the probe Fam-CGACTGTGTGGTCCGGCCCATC-Tamra, directed to the NS5 region of the yellow fever virus [12 (link),13 (link)]. For constructing the standard curves, the 83 bp fragments from the NS5 viral region obtained by PCR [12 (link)] was cloned into a TOPO TA Cloning vector, according to the manufacturer’s instructions (Invitrogen®). Serial dilutions from 107 to 102 plasmid copies per reaction were used to generate the calibration curves for the qRT-PCR assays. The lowest detected concentration was established in 25 copies/reaction.
3
Genomic DNA and RNA Extraction from Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As already described by Bianchessi [17 (link)], genomic DNA (gDNA) was isolated from blood samples in ethylenediamine tetraacetic acid (EDTA) using a Gentra Puregene® Blood Core Kit B (Qiagen, Venlo, The Netherlands; Carlsband, CA, USA).
RNA samples were collected in TempusTM Blood RNA Tubes (Life Technologies, Carlsbad, CA, USA) and extracted with a TempusTM Spin RNA Isolation Kit within 5 days. DNase treatment with Absolute RNA Wash Solution was performed for all samples during the RNA extraction protocol. RNA samples were reverse-transcribed using 50 units of High-Capacity cDNA Reverse Transcription mix (Life Technologies) and 20 units of RNAse inhibitor (Ambion, Austin, TX, USA). β-2-Microglobulin amplification was used as a quality control for retro-transcription.
RNA samples were collected in TempusTM Blood RNA Tubes (Life Technologies, Carlsbad, CA, USA) and extracted with a TempusTM Spin RNA Isolation Kit within 5 days. DNase treatment with Absolute RNA Wash Solution was performed for all samples during the RNA extraction protocol. RNA samples were reverse-transcribed using 50 units of High-Capacity cDNA Reverse Transcription mix (Life Technologies) and 20 units of RNAse inhibitor (Ambion, Austin, TX, USA). β-2-Microglobulin amplification was used as a quality control for retro-transcription.
4
DNA and RNA Isolation from Blood Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from ethylenediamine tetraacetic acid (EDTA) blood samples using a Gentra® Puregene® Blood Core Kit B (Qiagen, Venlo, Netherlands Carlsband, California, USA). RNA samples were collected in Tempus Blood RNA Tubes (Life Technologies, Carlsbad, CA) and extracted with a Tempus™ Spin RNA Isolation Kit within 4 days. DNase treatment with Absolute RNA Wash Solution was performed for all samples during the RNA extraction protocol. RNA samples (1 μg) were reverse‐transcribed using 50 units of High‐Capacity cDNA Reverse Transcription mix (Life Technologies) and 20 units of RNAse inhibitor (Ambion®, Austin, TX). Beta‐2‐Microglobulin amplification was used as a quality control for retro‐transcription.
5
Characterizing TH17 Cell TCR Repertoire
6
Characterizing TH17 Cell TCR Repertoire
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Il23rGFP/+ mice were maintained in SFB-free conditions to guarantee low TH17 background levels. To induce a robust TH17 response, the mice were orally infected with H. hepaticus and injected intraperitoneally with 1mg anti-IL10RA (clone 1B1.3A, Bioxcell) every week from the day of infection. After two weeks, LI GFP+ CD4+ T cells were sorted on the BD Aria II and deposited at one cell per well into 96-well PCR plates pre-loaded with 5 μl high-capacity cDNA reverse transcription mix (Thermo Fisher) supplemented with 0.1% Triton X-100 (Sigma-Aldrich). Immediately after sorting, whole plates were incubated at 37 °C for 2 h, and then inactivated at 85°C for 10 min for cDNA preparation. A nested multiplex PCR approach described previously was used to amplify the CDR3α and CDR3β TCR regions separately from the single cell cDNA31 (link). PCR products were cleaned up with ExoSap-IT reagent (USB) and Sanger sequencing was performed by Macrogen. Open reading frame nucleotide sequences of the TCRα and TCRβ families were retrieved from the IMGT database (http://www.imgt.org )32 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!