Gentlemacs lung dissociation kit

Muc5AC (Forward–TCTACTGACTGCACCAACACAT; Reverse–GTGCAGTCCCCATTACTGT) and Muc5B (Forward–GCCTTGTCTCAGTCCCTCCTG; Reverse–TGACTGTCTCCGGTGAGTTCTA) were quantified in mouse by extracting RNA from flash frozen, pulverized left lung lobes using TRIzol (Invitrogen 15596018). RNA was purified using the RNeasy kit (Qiagen). 1 μg of RNA was reverse transcribed to cDNA (Promega) and SYBR Green Supermix (Bio-Rad) was used to quantify mRNA expression using RT-qPCR. For Drp1 (Forward–AAGCCCTGAGCCAATCCATC; Reverse–CTCGATGTCCTTGGGCTGAT) quantification, lung epithelial cells were isolated from lungs of Ctrl or ∆Epi-Drp1 mice on doxycycline diet for 10 days using the GentleMACS lung dissociation kit (Miltenyi Biotech) followed by the EasySep mouse epithelial cell enrichment kit II (STEMCELL Technologies). Isolated epithelia were lysed in TRIzol and RNA was isolated and reverse transcribed in the same manner as whole lung lysates. Drp1 expression in MTECs was also quantified by RT-qPCR following TRIzol lysis. Expression values were normalized to the geometric mean of GAPDH (Forward–AGGTCGGTGTGAACGGATTTG; Reverse–TGTAGACCATGTAGTTGAGGTCA), PP1 (Forward–TTTTCATCTGCACTGCCAAG; Reverse–TCGAGTTGTCCACAGTCAGC), and RP2 (Forward–TTGCCAGCAATTTCGTGTGA; Reverse–CCAGTTGAGCTCTCCTGACA) using the ∆∆CT method.

Boostrix (GSK) was purchased from the Ohio State University Medical Center Pharmacy. Purified filamentous hemagglutinin (FHA) from B. pertussis was purchased from List Biologicals (Campbell, CA) or over-produced in E. coli. Detoxified pertussis toxin (PT) purified from B. pertussis was purchased from List Biologicals. BcfA was over-produced in E. coli and purified as described previously (29 (link)) with endotoxin levels as reported in (30 (link)). Pertactin (PRN) was purchased from List Biologicals. Endotoxin in FHA and PT was <20 EU/mg. Endotoxin levels in all proteins were below that of Boostrix (33 (link)). GentleMACS lung dissociation kit was purchased from Miltenyi Biotec. RPMI, Ca²⁺/Mg²⁺-free PBS, ACK red blood cell lysis buffer, protein transport inhibitor, and fixation/permeabilization buffers were purchased from Life Technologies. Fetal bovine serum was purchased from Sigma-Aldrich (St. Louis, MO). U-Plex biomarker assay was purchased from Meso Scale Diagnostics (Rockville, MD). Antibodies and live/dead stains for flow cytometry were purchased from Life Technologies, BioLegend, or BD Biosciences.