Anti gfp antibody sc 9996

GFP-TalinB overexpressing construct was created by PCR of the TalinB coding sequence and the product was ligated to pDM317 Dictyostelium plasmid [36 (link)]. Plasmids with TalinBK16A mutations were created by quick-change PCR using pDM317talb plasmid as template and the primers F5′GATAAACAAGTTGCAGCAATGAAGTTCTC3′ and R5′CATTGCTGCAACTTGTTTATCTCTAACG3′. The RA domain construct (1–122) was created by PCR from a full length talB construct, digested by BamHI and ligated to pGEX4T-3 vector (GE Healthcare). All constructs were sequenced and the expression of proteins in Dictyostelium was further confirmed by means of Western Blot with anti-GFP antibody (sc-9996, Santa Cruz).

DL-Sulforaphane (Sfn) (#S4441), MG132 (#474787), SBI0206965 (#SML1540-5MG), Actinomycin D (#A1410), Hemin (#H9039) were from Sigma-Aldrich (Vienna, Austria) and dissolved in DMSO (to at least 1000X stocks), stored at −80°C and added to the cells at the indicated concentrations (maximal final DMSO concentration of 0.2%). Antibodies against AMPKα (#2532), Keap1 (#7705), Nrf2 (#12721), α/β-Tubulin (#2148), Lamin (#12586) as well as secondary horseradish peroxidase-coupled antibodies against mouse (#7076) and rabbit (#7074) were purchased from Cell Signaling (Frankfurt am Main, Germany) and used at 1:1,000 dilution for Western Blotting and 1:100 for immunoprecipitation. Anti-Bach1 (#sc-271211) and anti-GFP antibody (#sc-9996) came from Santa Cruz (Heidelberg, Germany), used at 1:300 dilutions for Western Blotting and 1:50 for immunoprecipitation. The α-actin antibody (#69100) was from MP Biologicals (Illkirch, France) and used in a 1:5,000 dilution.

For detection of proteins, the proteins resolved by SDS-PAGE and western blotting using standard protocols. A rat monoclonal antibody anti-HA antibody (3F10; Roche Life Sciences, IN) was used to detect HA-tagged TRPM7 and TRPM6. Anti-FLAG M2 antibody (Sigma, MO) was used to detect FLAG-TRPM7. A mouse monoclonal antibody anti-SBP (sc-101595; Santa Cruz Biotechnology, Inc., TX) and a rabbit polyclonal anti-TRPM7-C47 were used to detect SBP-TRPM77 (link). An anti-GFP antibody (sc-9996; Santa Cruz Biotechnology, Inc., TX) was used to detect GFP-TRPM7-Cterm. An anti-pSer antibody (#2981; Cell Signalling Technology, Inc., MA) was used to detected phosphorylated TRPM6 protein.

The experiments were performed by lysing cells from 6-well plate wells, 48h post transfection, in the Co-IP buffer (150 mM NaCl, 50 mM Tris-HCl pH 8, 1mM EDTA, 0.5% NP40, 10% glycerol) with protease inhibitor cocktail (Sigma) for 15 min on ice, with additional mechanical lysis using fine-needle syringes. Lysates were pre-cleared by 1h rotation with agarose-protein G beads (washed with the Co-IP buffer), centrifuged for 20 min at 13000 g at 4°C (to clear the beads and the cell debris), input samples were collected and the main lysates were incubated with rotation overnight at 4°C with the 0.5 μg anti-GFP antibody (sc-9996, Santa Cruz) or anti-FLAG antibody (sc-166355, Santa Cruz). The agarose-protein G beads (washed with the Co-IP buffer) were added and the lysates were rotated for additional 1h. The beads were spun down, washed 3x with the co-IP buffer, resuspended in the Laemmli sample buffer, incubated at 95°C for 5 min, and the whole samples were loaded to the SDS-PAGE gel for the western blot. Inputs were blotted in parallel.