Mir 338 3p mimic

Cells were transfected with Lipofectamine 2000 Reagent (Invitrogen) following the manufacturer's protocol. A miR-338-3p mimic, miR-338-3p inhibitor or their corresponding controls (m-NC for mimic and i-NC for inhibitor) (Ribobio, Guangzhou, China) was used for transfection in this study.
For dual-luciferase reporter assay, the 3′UTR of ZEB2 that contained the wild-type or mutant putative binding site was inserted into the psiCHECK2 vector (Promega, Madison, WI). The same procedure was conducted for MACC1. The dual-luciferase reporter plasmid psiCHECK2-wMACC1 (containing the wild-type MACC1 putative 3′UTR binding site) and psiCHECK2-mMACC1 (contained mutant MACC1 3′UTR) were constructed. The primer sequences used for the dual-luciferase reporter plasmid are shown in the Supplementary Table 1.
For upregulated ZEB2 expression, GFP-tagged of human ZEB2, transcript variant 1 as transfection-ready DNA and a PrecisionShuttle mammalian vector with C-terminal tGFP tag were used (ORIGENE, Rockville, MD). AGS and MKN-28 cells were transfected according to the manufacturer's protocol. For MACC1 upregulation, the expression plasmid pBaBb-MACC1 was constructed as previously reported [21 (link)], and pBaBb-vector was used as control.

The miR-338-3p mimic, miR-338-3p inhibitor, miRNA mimic NC, and miRNA inhibitor NC were purchased from RiboBio (Guangzhou, China). Transfection was carried out using according to the manufacturer’s instructions.

Human glioma cells (HS683, A172, and U251) and primary normal human astrocytes (NHA) were provided by KeyGEN Biotech (Nanjing, China). All cells were cultured in Dulbecco’s modified Eagles Medium containing 10% fetal bovine serum (Gibco, Carlsbad, CA) and then maintained at 37°C in an environment with 5% CO₂.
RiboBio (Shanghai, China) designed and synthesized agomiR-338-3p, miR-338-3p mimic, agomiR negative control (agomiR-NC), and mimic-NC. THBS1 sequences were subcloned into a plasmid vector (pcDNA3.1) with an empty vector as the NC. Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used to introduce the mimics and vectors into U251 and A172 cells. After 48 h of transfection, the efficiency of the transfections was determined by performing quantitative polymerase chain reaction (qPCR).

RCC cells were seeded into the 6-well plate and were respectively transfected with 5nM miR-338-3p inhibitor, miR-338-3p mimic or miR-control. The Caki-1 and 786-O cells were transfected with Lipofectamine 2000 (Invitrogen). miR-338-3p inhibitor (5′-GCAAAAAUUAGUGUGCGCCAAA-3′), miR-338-3p mimic (5′-UUUGAGCAGCACUCAUUUUUGC-3′) and miR-control (5′-CAGUAC UUUUAGUGUGUACAA-3′) were purchased from RiboBio (Guangzhou, China), the sequence of miR-negative control was heterogenous from any known human genome sequence so as to eliminate the potential non-sequence-specific effect.

To simulate the overexpression of the hsa_circ_0075542 recombinant plasmid, the linear sequence of hsa_circ_0075542 (chr6:6,222,265–6,225,093) was cloned into the pLC5-ciR vector, a circRNA overexpression vector purchased from Guangzhou Geneseed Biotech Co. (China), using the following primers (5` – 3`): TTGACATTAATATTTCTTCTTTCGAATTCGTGAATGCCAAAGATGACGAAGGT (forward) and AGTATGGAGTTGTTAGCTAGGATCCCACACTGAATCCTTGGTGAGTTTGGAAT (reverse). The construction was named ov-circ_0075542. Negative control miRNA (miR-NC), miR-1197 mimic, miR-338-3p mimic, miR-548p mimic, miR-548 c-3p mimic, miR-545 mimic, and miR-634 mimic were purchased from Guangzhou RiboBio Co., Ltd. (China).

The short-hairpin SNHG17 (sh-SNHG17: 5′-GAUUGUCAGCUGACCUCUGUCCUGU-3′) and negative control shRNA (sh-NC: 5′-UUCUCCGUUCGUGUCACGUUU-3′) were designed and constructed by GenePharma Co., Ltd. (Shanghai, China). The miR-338-3p mimic (5′-UUUGAGCAGCACUCAUUUUUGC-3′), NC mimic (5′-CAGUACUUUUAGUGUGUACAA-3′), miR-338 inhibitor (5′-CAACAAAAUCACUGAUGCUGGA-3′), and NC inhibitor (5′-CAGUACUUUGUGUAGUACAA-3′) were purchased from RiboBio Co., Ltd. (Guangzhou, China). The full-length cDNA of the SOX4 gene was PCR-amplified and then inserted into the pcDNA3.1 vector. Oligonucleotides and plasmids were transfected into cells using Lipofectamine 2000 (Invitrogen) following the manufacturer’s protocol.