Psicor ef1a mch puro

To generate the T7-VEE-mCherry construct, T7-VEE-OKS-iG (#58974; Addgene, Cambridge, MA, USA) was linearized by NdeI/NotI digestion and modified by removing the OKS-iG sequence [42 ]. This vector was renamed as T7-VEE. pSicoR-Ef1a-mCh-Puro (#31845; Addgene) was digested with the same restriction enzymes, and then the mCherry-Puro sequence was introduced to the T7-VEE vector. The pTNT-B18R vector (#58978; Addgene) was amplified by PCR, and the amplicon was purified by gel extraction. These linearized DNA templates were used for in vitro transcription. The synthesis of T7-VEE-mCherry and pTNT-B18R RNA was performed with the RiboMAX Large Scale RNA Production System-T7 Kit (Promega, Madison, WI, USA). The ScriptCap m7G Capping System (Epicentre, Madison, WI, USA) was used for 5′ capping, which confers mRNA stability and efficient translation. After the 5′ mRNA- capping reaction, a poly (A) tail was added using poly (A) polymerase (Epicentre). These individual RNAs were purified by ammonium acetate and isopropanol precipitation, resuspended in the RNase-free water, and stored at −80 °C. A PCR was performed to confirm that both mRNAs were properly synthesized.

Briefly, pSicoR-Ef1a-mCh-Puro (Addgene #31845) was double-digested with AfeI and SmaI to replace mCherry coding sequence with that of RBLP with matching sticky ends in-frame. S838A/T841A substituted plasmid was made with QuikChange Site-directed mutagenesis kit (Agilent), following manufacturer’s recommendations and mutagenic primers TTAGTATCAATTGGTGAAGCATTCGGGGCTTCTGAGAAGTTCCAGAAA and TTTCTGGAACTTCTCAGAAGCCCCGAATGCTTCACCAATTGATACTAA. HEK293 T cells at 70% confluency on 10-cm plates were transfected with 12 μg expression vector, 9 μg pMD2.G (Addgene #12259), and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies) following manufacturer’s recommendations. Two days later, the cell media was harvested and passed through a 0.45 μm filter. Jurkat cells (10⁶) were transduced with the filtrate containing 8 μg/ml polybrene. Transduced Jurkat cells were maintained in 0.3 μg/ml puromycin.