First-strand cDNA was synthesized from 1.0 μg DNA-free RNA using RevertAid Premium Reverse Transcriptase (Fermentas). The PCR mixture (10 μl total volume) comprised 2 μl of LightCycler FastStart DNA Masterplus SYBR Green I Master Mix (Roche), 0.5 μl of each primer (10 μM), 1 μl cDNA and 6μl water. qRT-PCR was performed on a LightCycler 1.5 instrument (Roche), initiated by 5 min at 95°C, then followed by 45 cycles of 95°C for 10 s, 60°C for 10 s and 72°C for 15 s, and completed with a melting curve analysis program. No-template controls and melting curve analyses were included in every reaction. The actin gene was included as an internal control, using ACT-F (5’-CATCCCTCAGCACCTTCC-3’) and ACT-R (5’-CCAACCTTAGCACTTCTCC-3’) as primers [31 ]. Primers for the qRT-PCR are list in Table 1 .
Lightcycler faststart dna masterplus sybr green 1 master mix
Manufactured by Roche
The LightCycler FastStart DNA MasterPLUS SYBR Green I Master Mix is a ready-to-use reaction mix for real-time PCR amplification and detection using the SYBR Green I fluorescent dye. It is designed to provide rapid, sensitive, and reliable real-time PCR results.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using lightcycler faststart dna masterplus sybr green 1 master mix
1
Quantitative Real-Time PCR Protocol
2
Real-Time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For real-time PCR, gene-specific oligonucleotide primers were designed and are described in Supplementary Table S7 at JXB online. The gene specificity of each pair of primers was double checked by melting curves and product resequencing, according to the procedures described by Yin et al. (2008) (link). The EjACT gene was employed as the internal control for monitoring the abundance of the mRNA. The sequences of EjACT primers are described in Supplementary Table S7 .
Real-time PCR were performed on a LightCycler 1.5 instrument (Roche), initiated by 5 min at 95 °C and followed by 45 cycles of 95 °C for 5 s, 60 °C for 5 s, and 72 °C for 10 s, and completed with a melting- curve analysis program. The PCR mixture (10 μl total volume) comprised 2 μl of 5× LightCycler FastStart DNA MasterPLUS SYBR Green I Master Mix (Roche), 0.5 μl of each primer (10 μM), 1 μl of diluted cDNA and 6μl PCR-grade H2O. No-template controls and melting-curve analysis were included for each gene during each run.
Real-time PCR were performed on a LightCycler 1.5 instrument (Roche), initiated by 5 min at 95 °C and followed by 45 cycles of 95 °C for 5 s, 60 °C for 5 s, and 72 °C for 10 s, and completed with a melting- curve analysis program. The PCR mixture (10 μl total volume) comprised 2 μl of 5× LightCycler FastStart DNA MasterPLUS SYBR Green I Master Mix (Roche), 0.5 μl of each primer (10 μM), 1 μl of diluted cDNA and 6μl PCR-grade H2O. No-template controls and melting-curve analysis were included for each gene during each run.
3
Real-Time PCR Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene-specific oligonucleotide primers were designed for real-time PCR and are listed in Supplementary Table 6 . The LightCycler 1.5 instrument (Roche) was used for real-time PCR. It was initiated by 5 min at 95 °C followed by 45 cycles of 95 °C for 5 s, 60 °C for 5 s, and 72 °C for 10 s. Finally, it was completed with a melting-curve analysis. The PCR mixture (10 μl total volume) contained 2 μl of 5× LightCycler FastStart DNA MasterPLUS SYBR Green I Master Mix (Roche), 0.5 μl of each primer (10 μM), 1 μl of diluted cDNA, and 6 μl of PCR-grade H2O. Each run included no-template controls and a melting-curve analysis.
4
Loquat Transcriptional Profiling via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA and cDNA for different tissues and developmental stages of loquat were prepared according to the protocol described by Zeng et al. (2015) (link). For Real-time PCR, gene specific primers were designed using Primer3 (vision 0.4.0)1 . The specificity of these primers was determined by examining the melting curve and product resequencing. All reactions were normalized using the Ct value corresponding to the loquat actin gene EjACT (Fu et al., 2012 (link)). Primers for EjODO1 were as follow: forward 5′- ATTCCCCAAGCAATGAGTCTCAG-3′; reverse 5′- TGCTAAGCTATTCTCCTCCGTTGG -3′. Real-time PCR analysis was performed with a LightCycler 1.5 instrument (Roche) using a mixture (10 μl total volume) comprising 2 μl of 5 × LightCycler FastStart DNA MasterPLUS SYBR Green I Master Mix (Roche), 0.5 μl of each primer (10 μM), 1 μl of diluted cDNA and 6 μl PCR-grade H2O. The PCR conditions included an initial denaturation for 5 min at 95°C, followed by 45 cycles of 95°C for 5 s, 60°C for 5 s, and 72°C for 10 s, and completed with a melting- curve analysis program. Three biological replicates were included for each sampling point or tissue.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!