Non target shrna control vector

Manufactured by Merck Group

The Non-Target shRNA Control Vector is a plasmid-based tool used in RNA interference (RNAi) experiments. It contains a non-targeting short hairpin RNA (shRNA) sequence that does not target any known genes in the host organism. This vector serves as a negative control to help researchers evaluate the specificity and efficiency of their RNAi experiments.

Automatically generated - may contain errors

Lab products found in correlation

Sirna duplexes, by Thermo Fisher Scientific (1 mentions) Amaxa mouse neuron nucleofector kit, by Lonza (1 mentions) Puromycin, by Wisent (1 mentions) Keratinocyte sfm 1x, by Thermo Fisher Scientific (1 mentions) Hek293t 17, by Merck Group (1 mentions) Hek293t 17, by American Type Culture Collection (1 mentions) Polybrene, by Merck Group (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Non-target control (NTC) shRNA lentiviral vectors MISSION Non-Target shRNA Control Vector MISSION non-target shRNA control vector (SHC002) MISSION® Non-Target shRNA control vector (pLKO.1-NTC) Non-target shRNA control Control shRNA ShRNA vectors Control vector

4 protocols using non target shrna control vector

p62/SQSTM1 Knockdown and Autophagy Regulation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A set of p62/SQSTM11 shRNA vectors (SHCLNG-NM_003900), and a non-target shRNA control vector were purchased from Sigma-Aldrich (St. Louis, MO) for the p62/SQSTM1 knockdown experiments. Lentivirus production and viral infection were done as previously described [23] (link). Small interfering RNA (siRNA) duplexes were purchased from Ambion (Austin, TX) targeting ATG7 (ID# s20650 and s20651). Negative Control #1 siRNA was used as control. siRNAs (30 µM per 100 µl transfection solution) were electroporated using Lonza's Nucleofector and the Cell Line Neucleofection kit V (Walkersville, MD) As described in [23] (link)

Kuo W.L., Sharifi M.N., Lingen M.W., Ahmed O., Liu J., Nagilla M., Macleod K.F, & Cohen E.E. (2014). p62/SQSTM1 Accumulation in Squamous Cell Carcinoma of Head and Neck Predicts Sensitivity to Phosphatidylinositol 3-Kinase Pathway Inhibitors. PLoS ONE, 9(3), e90171.

+ Open protocol

+ Expand

Hdac3 knockdown in cortical neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hdac3 (NM_010411)
short hairpin RNA (shRNA) clone (TRCN0000039391, 5’ CCGGGTGTTGAATATGTCAAGAGTTCTCGAGAACTCTTGACATATTCAACACTTTTTG 3′; Sigma) and Non-Target shRNA Control Vector (Sigma) were introduced into immature primary cortical neurons (E17) using the Amaxa mouse Neuron Nucleofector kit as directed by the manufacturer (Lonza). On Day 6, HDAC3 knockdown was confirmed by Real-time RTPCR and whole-cell lysate Western blots.

Sleiman S.F., Henry J., Al-Haddad R., El Hayek L., Abou Haidar E., Stringer T., Ulja D., Karuppagounder S.S., Holson E.B., Ratan R.R., Ninan I, & Chao M.V. (2016). Exercise promotes the expression of brain derived neurotrophic factor (BDNF) through the action of the ketone body β-hydroxybutyrate. eLife, 5, e15092.

+ Open protocol

+ Expand

Lentiviral shRNA Knockdown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

shRNA vectors (Supplementary Table 6) or SHC002 MISSION Non-Target shRNA control vector (Sigma) along with lentivirus packaging plasmids pCMV-dR8.2 and pCMV.VSV.G (Addgene) were transfected in HEK293T/17 (ATCC #CRL: 11268). Target LNCaP, PC3, or RWPE-1 cells (ATCC #: CRL-11609) grown in Keratinocyte-SFM 1X (Gibco) were seeded 24 hours following transfection. Supernatants from HEK293T/17 cells were collected 48 hours after transfection, passed through a 0.45-μm SFCA filter, and applied on target cells along with Polybrene (8 μg/mL) (Sigma). Cells were selected with puromycin (Wisent) for 72 hours. Immediately following selection, cells were plated for growth assays and counted at the times indicated.

Mohammad A.H., Assadian S., Couture F., Lefebvre K.J., El-Assaad W., Barrès V., Ouellet V., Boulay P.L., Yang J., Latour M., Furic L., Muller W., Sonenberg N., Mes-Masson A.M., Saad F., Day R, & Teodoro J.G. (2019). V-ATPase-associated prorenin receptor is upregulated in prostate cancer after PTEN loss. Oncotarget, 10(48), 4923-4936.

+ Open protocol

+ Expand

Knockdown of CD147 and CD44s in MRC-5 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MRC-5 cells were incubated with supernatant containing lentivirus carrying the shCD147 or shNT construct to generate CD147 knockdown cells. Non-Target shRNA Control Vector was obtained from Sigma (St. Louis, MO). The sequence for Non-Target shRNA Control Vector was: sense 5′-CGGCAACAAGATGAAGAGCACCAACTC-3′, anti-sense 5′-GAGTTGGTGCTCTTCATCTTGTTGTTTTT-3′. CD147 shRNA (corresponding nucleotide positions 352–373 of CD147 cDNA), sense 5′-CCCATCATACACTTCCTTCTT-3′, anti-sense 5′-AAGAAGGAAGTGTATGATGGG-3′. The small interfering RNA (siRNA) sequences targeting CD44s were designed and synthesized by Tsingke Biological Technology (Xi’an, China). The sequences were listed in Supplementary Table 2. The MRC-5 cells were transfected with the siRNAs using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, US).

Wu J., Chen L., Qin C., Huo F., Liang X., Yang X., Zhang K., Lin P., Liu J., Feng Z., Zhou J., Pei Z., Wang Y., Sun X.X., Wang K., Geng J., Zheng Z., Fu X., Liu M., Wang Q., Zhang Z., Bian H., Zhu P, & Chen Z.N. (2022). CD147 contributes to SARS-CoV-2-induced pulmonary fibrosis. Signal Transduction and Targeted Therapy, 7, 382.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!