Total RNAs were isolated with the RNeasy Mini Kit (Qiagen, Hilden, Germany) and then reverse transcribed into cDNA with iScript cDNA synthesis kit (Bio-Rad Laboratories, CA, USA). For quantitative miRNA analysis, the Bulge-LoopTM miRNA qPCR Primer Set (RiboBio) was used to determine the expression levels of miRNAs with Takara SYBR Premix Ex TaqTM (TliRNaseH Plus) in ABI-7900 Real-Time PCR Detection System (7900HT, Applied Biosystems, CA, USA). U6 was used as an internal control. For mRNA analysis, cDNA was synthesized using Bio-Rad iScriptTM cDNA Synthesis Kit (Bio-Rad) and was subjected to 40 cycles of quantitative PCR with Takara SYBR Premix Ex TaqTM (Tli RNaseH Plus, Japan) in ABI-7900 Real-Time PCR Detection System. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Primer sequences (forward and reverse) used in the present study are as follows: ANP, AGCCGTTCGAGAACTTGTCTT and CAGGTTATTGCCACTTAGGTTCA; BNP, GAGGTCACTCCTATCCTCTGG and GCCATTTCCTCCGACTTTTCTC; α-SMA, GTCCCAGACATCAGGGAGTAA and TCGGATACTTCAGCGTCAGGA; Collagen I, GCTCCTCTTAGGGGCCACT and CCACGTCTCACCATTGGGG; Collagen III, CTGTAACATGGAAACTGGGGAAA and CCATAGCTGAACTGAAAACCACC; GAPDH, TGGATTTGGACGCATTGGTC and TTTGCACTGGTACGTGTTGAT. The relative expression level was calculated using the 2-ΔΔCt method.
Iscript cdna synthesis kit
Manufactured by Bio-Rad
Sourced in United States, Germany, Italy, Canada, United Kingdom, France, Netherlands, Switzerland, Sweden, Belgium, Japan, Australia, China, India, Spain, Denmark, Austria, Norway
The IScript cDNA Synthesis Kit is a reagent kit used for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains all the necessary components to perform this reaction, including a reverse transcriptase enzyme, reaction buffer, and oligo(dT) primers.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (1954 mentions)
Trizol reagent, by Thermo Fisher Scientific (1895 mentions)
Trizol, by Thermo Fisher Scientific (1144 mentions)
Iq sybr green supermix, by Bio-Rad (1062 mentions)
Itaq universal sybr green supermix, by Bio-Rad (705 mentions)
Rneasy kit, by Qiagen (529 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (458 mentions)
Rneasy plus mini kit, by Qiagen (427 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (339 mentions)
Ssofast evagreen supermix, by Bio-Rad (313 mentions)
Cfx96 real time system, by Bio-Rad (313 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (291 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (282 mentions)
Nanodrop, by Thermo Fisher Scientific (282 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (281 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (246 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (237 mentions)
Sybr green supermix, by Bio-Rad (235 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (218 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (207 mentions)
11 729 protocols using iscript cdna synthesis kit
1
Comprehensive RNA Expression Analysis
2
Quantifying Neuronal Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary neurons were transduced at DIV 8 with lentiviral vectors encoding CTF-V5 or PCDH19 shRNA and relative controls (empty cFUW vector and scramble, respectively). Total mRNA was extracted at DIV 12 using NucleoSpin RNA Kit (Macherey-Nagel) and cDNA was synthesized with iScript cDNA Synthesis Kit (Biorad) according to the manufacturer’s instructions. RT-PCR was performed according to standard procedures (Longaretti et al., 2020 (link)) by using RPSA as endogenous control and the primers in Table S9 .% of LSD1 splicing isoforms evaluation was performed as in (Zibetti et al., 2010 (link)).
hiPSCs-derived neurons were infected at DIV 1 with lentiviral vectors encoding PCDH19 shRNA and a relative control (scramble).
At DIV 21 or 35, as indicated, total mRNA was extracted using NucleoSpin RNA Kit (Macherey-Nagel). cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions. To measure mRNA expression, the primers inTable S9 were used.
hiPSCs-derived neurons were infected at DIV 1 with lentiviral vectors encoding PCDH19 shRNA and a relative control (scramble).
At DIV 21 or 35, as indicated, total mRNA was extracted using NucleoSpin RNA Kit (Macherey-Nagel). cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions. To measure mRNA expression, the primers in
3
Evaluating Stress Response in L. monocytogenes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of total RNA was carried out by following the manufacturer's instructions of a UNIQ‐10 column Trizol total RNA extraction kit (Sangon Biotech Co., Ltd.) and an iScript cDNA synthesis kit (Bio‐Rad Laboratories, Inc.), respectively. Before RNA extraction, 20 mg/ml lysozyme solution (Tiangen Biotech Co., Ltd.) was added to pellets and incubated at 37°C for 40 min to lyse the cells. The purity and concentration of the extracted RNA were checked using a microspectrophotometer (SMA4000, Merinton Instrument, Inc.), and the integrity of extracted RNA was measured by 1.5% agarose gel electrophoresis.
For the first‐strand cDNA synthesis, 800 ng of total RNA was used for reverse transcription according to the instructions of the iScript cDNA synthesis kit (Bio‐Rad Laboratories, Inc.). Real‐time qRT‐PCR was performed using a StepOnePlus Real‐Time PCR System (ABI) to evaluate the transcriptional levels of stress/virulence‐related genes. The specific primers of genes and associated functional descriptions were designed and synthesized by Sangon Biotech Co. Ltd., which are listed in Table1 . The relative expressions of these stress/virulence‐related genes in L. monocytogenes were calculated using the 2−△△Ct method (Li et al., 2019 (link)).
For the first‐strand cDNA synthesis, 800 ng of total RNA was used for reverse transcription according to the instructions of the iScript cDNA synthesis kit (Bio‐Rad Laboratories, Inc.). Real‐time qRT‐PCR was performed using a StepOnePlus Real‐Time PCR System (ABI) to evaluate the transcriptional levels of stress/virulence‐related genes. The specific primers of genes and associated functional descriptions were designed and synthesized by Sangon Biotech Co. Ltd., which are listed in Table
4
RNA Extraction and qRT-PCR Analysis of DHT-Treated LNCaP Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA from DHT-treated and untreated LNCaP cells was performed using the RNeasy plus spin column kits (Qiagen, Valencia, CA, USA) according to the manufacturer protocol. Complementary DNAs (cDNAs) were prepared with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, CA, USA). qRT-PCR analysis was performed using the SYBR Green Master CFX Connect Real-Time PCR System (Bio-Rad Laboratories, CA, USA).28 (link),29 (link) Preparation of complementary DNAs (cDNAs) and qRT-PCR was conducted by the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, CA, USA) and the SYBR Green Master on a CFX Connect Real-Time PCR System (Bio-Rad Laboratories, CA, USA), respectively.29 (link),30 (link) Expression of eRNA transcripts was calculated by the delta–delta Ct method with β-actin expression used as a normalizing internal control. The PCR primer sets used in the study are listed in Supplementary Table 1
5
Quantifying BACE1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated and extracted from treated cells using the 5 prime “PerfectPure RNA tissue kit” (5 Prime, Inc., Gaithersburg, MD) following manufacturer’s instructions and as described previously [36 (link)]. cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). cDNA was obtained by reverse transcribing 1 μg of extracted RNA using an iScript cDNA synthesis kit” (BioRad, Hercules, CA). The quantitative Real-time RT-PCR was performed using TaqMan chemistry using “Assays-on-Demand” probes (ABI, Foster City, CA) for human BACE1 (BACE1 gene) (Hs01121195_m1) and mouse Bace1 (Bace1 gene) (Mm00478664_m1), The amplification was performed using the “StepOnePlus” PCR System (ABI, Foster City, CA). The expression of specific transcripts amplified was normalized to the expression of 18s rRNA. The data were quantified and expressed as fold-change compared to the control by using the ΔΔCTmethod.
6
Quantifying BMP4 Expression in HUVECs and Mouse Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cultured HUVECs or previously homogenized mouse tissues was isolated and purified using the SpeedTools kit (Biotools), or the RNeasy kit (170-8891; iScript cDNA Synthesis kit; BioRad). One μg of total RNA from each sample was retrotranscribed into cDNA with the iScript cDNA Synthesis kit (BioRad) in a final volume of 20 μL, following the manufacturer’s instructions. The resulting cDNA was used as a template for subsequent quantitative real-time PCR. For qRT-PCR assays of human BMP4, specific oligonucleotides labeled with FAM (Hs03676628_s1; TaqMan Gene Expression Assays, Applied Biosystems), and Roche’s FastStart Essential DNA Probes Master Mix containing Taq DNA Polymerase (Life Science). Amplification experiments were performed with the iQ5 thermal cycler (Bio-Rad). The qRT-PCR of murine Bmp4 was carried out using the iQTM SYBR® Green Supermix (170-8880; BioRad), and mouse Bmp4 specific oligonucleotides (Forward, CGTTACCTCAAGGGAGTGGA; Reverse, ATGCTTGGGACTACGTTTGG). DNA amplification was performed with the Roche LightCycler 96 thermal cycler, using human or murine 18S ribosomal RNA as an internal control. Samples were analyzed in triplicate, and each experiment was repeated at least three times. Results were normalized with respect to the expression levels of the 18S ribosomal RNA by the 2−ΔΔCt method.
7
Transcriptional Regulation of Nutrient Transport
8
Quantitative Gene Expression Analysis of UPR Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with RNEasy Mini Kit (Qiagen, Hilden, Germany). The concentration and quality of RNA were evaluated using the RNA 6000 Nano LabChip Kit (Agilent 2100 Bioer, Agilent Technologies Inc., Santa Clara, CA, USA). Reverse transcription of total RNA was carried out using IScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer's recommendations. Reverse transcription was performed using the IScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). The relative mRNA expression levels of PERK, ATF6, IRE1, CHOP, Nrf2, HO-1, and GCLC were performed in triplicate using the QuantiTect Primer Assay and QuantiTect SYBR Green PCR Kit (Qiagen) on the MyiQ Thermal Cycler (Bio-Rad). QuantiTect Hs-ACTB Assay (Qiagen) was used as normalizer. Normalized gene expression levels are given as the ratio between the mean value for the target gene and that for the β-actin in each sample.
9
Transcriptional Analysis of Leptin and IGF1
10
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen), as described in our previous report.22 For miRNA analysis, 1 μL of stem‐loop RT primer (1 μmol/L) and 2 μg of total RNA were used for first‐strand cDNA synthesis with an iScript™ cDNA Synthesis Kit (Bio‐Rad). For mRNA analysis, total RNA (4 μg) was transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio‐Rad). Quantitative RT‐PCR was performed on an Mx3005P qPCR System (Agilent Technologies) using an iQ™ SYBR® Green Supermix Kit (Bio‐Rad). The thermocycler programme for qPCR was as follows: initial denaturation at 95°C for 10 seconds, followed by 40 cycles of 10 seconds at 95°C and 20 seconds at 55°C. The threshold cycle (Ct value) was recorded. Quantitative RT‐PCR assays were repeated at least three times to ensure statistical rigour. Finally, mRNA and miRNA expression levels were calculated from three independent biological replicates. Fold changes in gene expression were calculated by relative quantification using the 2△△CT method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!