Polyfect

Manufactured by Qiagen

Sourced in Germany, United States, Netherlands, United Kingdom

Polyfect is a transfection reagent used for the delivery of nucleic acids, such as plasmid DNA, into mammalian cells. It facilitates the uptake and expression of the introduced genetic material within the target cells.

Automatically generated - may contain errors

Lab products found in correlation

211 protocols using polyfect

Validation of PGRMC1 Knockout Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

For validation of the PGRMC1 KO cell line, 1 × 10⁶ SV589 or 2 × 10⁶PGRMC1 KO cells were plated in 10-cm plates. The next day, the cells were transfected with 15 μg plasmid DNA (15 μg pcDNA 3.1 or 10 μg Flag-PGRMC1 plus 5 μg pcDNA3.1), with 50 μl Polyfect (Qiagen) according to manufacturer’s instructions for HeLa cells. The cells were harvested 24 h after transfection. For chase experiments, 1.6 × 10⁶PGRMC1 KO cells were seeded in a 10-cm plate. Two days after seeding, cells were transfected with a total of 15 μg plasmid DNA (10 μg Flag-PGRMC1 or Y113F Flag-PGRMC1 or 3X MUT Flag-PGRMC1, 5 μg CYP1A2-1XMyc, and/or pcDNA3.1), with 50 μl Polyfect (Qiagen) according to manufacturer’s instructions for HeLa cells. After 24 h, the cells were split at 1:6 to a 6-well plate. At 48 h posttransfection, the cells were treated with 100 μg/ml emetine (Sigma) for 4 h. For Flag coimmunoprecipitation, 1.5 × 10⁶PGRMC1 KO cells were seeded in a 10-cm plate. The next day the cells were transfected with 15.05 μg plasmid DNA (10 μg Flag-PGRMC1 or Y113F Flag-PGRMC1 or 3X MUT Flag-PGRMC1, 5 μg CYP1A2-1XMyc, 0.05 μg GP78-5XMyc, and/or pcDNA3.1) with 50 μl Polyfect (Qiagen) according to manufacturer’s instructions for HeLa cells. Cells were harvested 24 h after transfection and used immediately.

McGuire M.R., Mukhopadhyay D., Myers S.L., Mosher E.P., Brookheart R.T., Kammers K., Sehgal A., Selen E.S., Wolfgang M.J., Bumpus N.N, & Espenshade P.J. (2021). Progesterone receptor membrane component 1 (PGRMC1) binds and stabilizes cytochromes P450 through a heme-independent mechanism. The Journal of Biological Chemistry, 297(5), 101316.

+ Open protocol

+ Expand

Cellular Amino Acid Deprivation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 cells were cultured in growth medium containing Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific) with 10% fetal bovine serum, 1% penicillin-streptomycin, and 5 mM glutamine. Cells seeded in 3.5- or 6-cm plates, after 1 day, were transfected with cDNA constructs using Polyfect (Qiagen) as per the manufacturer’s instructions. For the amino acid deprivation protocol, after 48 hours, the growth medium was replaced with either serum-free F12+ (D2906, Sigma-Aldrich) medium or F12− (D9785, Sigma-Aldrich; without l-Leucine) medium for 2 hours, and, wherever indicated, F12− containing cells were stimulated with leucine (3 mM) for 15 min, and cells were lysed to proceed with Western blotting. HEK293 cells were seeded in 12-well plates for 1 day and then were transfected with RasGRP1 shRNA along with control shRNA constructs using Polyfect (Qiagen), according to the manufacturer’s instructions. The growth medium was removed after 24 hours, and the cells were lysed to prepare for Western blotting. Jurkat cells were also cultured similarly.

Eshraghi M., Ramírez-Jarquín U.N., Shahani N., Nuzzo T., De Rosa A., Swarnkar S., Galli N., Rivera O., Tsaprailis G., Scharager-Tapia C., Crynen G., Li Q., Thiolat M.L., Bezard E., Usiello A, & Subramaniam S. (2020). RasGRP1 is a causal factor in the development of l-DOPA–induced dyskinesia in Parkinson’s disease. Science Advances, 6(18), eaaz7001.

+ Open protocol

+ Expand

Prickle-USP9X Interaction Mapping

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T[37 (link)] cells were transfected with Flag-PRICKLE1 or Flag-PRICKLE2 with Polyfect (Qiagen), according to the manufacturer’s protocol. Cells were lysed in ice-cold NET-100 buffer after 48 hrs of incubation and immunoprecipitated overnight with anti-Flag beads at 4°C. Beads were washed for 5 minutes x 5 times in ice-cold NET-100 buffer. Immunoprecipitates were resolved by SDS-PAGE on a 4–20% gel and then subjected to anti-USP9X (1:500) immunoblot analysis. HRP-conjugated anti-rabbit secondary antibody was used at a 1: 2000 dilution. For mapping studies, HEK293T cells transfected with Flag-PRICKLE1, Flag-NPRICKLE1 or Flag-CPRICKLE1; Flag-PRICKLE2, Flag-NPRICKLE2 or Flag-CPRICKLE2 with Polyfect (Qiagen). Transfected cells were treated as described above. Lysates were also immunoprecipitated overnight with anti-Flag beads, eluates resolved by SDS-PAGE and then subjected to anti-USP9X Western blot analysis. Membranes were stripped and reprobed with anti-BCR antibodies (1:1000) overnight. HRP-conjugated anti-rabbit secondary antibody was used at a 1:10000 dilution. Blots were developed; and signals captured on X-ray films.

Paemka L., Mahajan V.B., Ehaideb S.N., Skeie J.M., Tan M.C., Wu S., Cox A.J., Sowers L.P., Gecz J., Jolly L., Ferguson P.J., Darbro B., Schneider A., Scheffer I.E., Carvill G.L., Mefford H.C., El-Shanti H., Wood S.A., Manak J.R, & Bassuk A.G. (2015). Seizures Are Regulated by Ubiquitin-specific Peptidase 9 X-linked (USP9X), a De-Ubiquitinase. PLoS Genetics, 11(3), e1005022.

+ Open protocol

+ Expand

Lentiviral Gene Transduction in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For lentiviral gene transduction, HEK293T cells transfected with the respective lentiviral vectors and packaging plasmids psPAX2 and pMD2.G using Polyfect (QIAGEN) or PEI. 24h later, medium was exchanged to RPMI, supplemented with 10% (v/v) FBS and antibiotics (100 U/ml penicillin, 100 mg/ml streptomycin). 48h after transfection, cell supernatants were harvested, filtered through 0.45 μm polyethersulfone filters (GE Healthcare) and supplemented with 8 μg/ml protamine sulfate (Sigma). Cells were infected by spinfection (2000 rpm, 45 minutes, room temperature). 24h after infection, medium was changed, 48h after infection, cells were selected with the respective antibiotics.

Heinz L.X., Lee J., Kapoor U., Kartnig F., Sedlyarov V., Papakostas K., César-Razquin A., Essletzbichler P., Goldmann U., Stefanovic A., Bigenzahn J.W., Scorzoni S., Pizzagalli M.D., Bensimon A., Müller A.C., King F.J., Li J., Girardi E., Mbow M.L., Whitehurst C.E., Rebsamen M, & Superti-Furga G. (2020). TASL is the SLC15A4-associated adaptor for IRF5 activation by TLR7-9. Nature, 581(7808), 316-322.

+ Open protocol

+ Expand

Autophagy Regulatory Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hydrogen peroxide, bafilomycin, antifade gold mounting medium, FBS,
L-glutamine, penicillin /streptomycin, DMEM without glucose, DMEM without
sodium pyruvate for H2O2 treatment medium, PVDF membrane, DMSO cell culture
grade, Lipofectamine 2000, Lipofectamine 3000 were purchased from Thermo
Fisher Scientific. Polyfect was purchased from qiagen. Antibodies for actin,
LC3, ATG5, myc, VPS34, ULK ser 317, ULK ser 757, ATG 13, ATG 13pSer 318,
Beclin1, Beclin Ser 15, VPS34 Ser 249, AMPK, PAMPK Thr 172,Flag, GST,
HA,FIP200, ATG101 were purchased from Cell Signaling Technology. ULK1ser555
and ULK ser 777 were from Millipore. ULK1 for immunoprecipitation was
purchased from Sigma. ULK1 for western blots was purchased from Santacruz
Biotechnology. Anti-mouse IPMK was developed in our lab.

Guha P., Tyagi R., Chowdhury S., Reilly L., Fu C., Xu R., Resnick A.C, & Snyder S.H. (2019). IPMK Mediates Activation of ULK Signaling and Transcriptional Regulation of Autophagy Linked to Liver Inflammation and Regeneration. Cell reports, 26(10), 2692-2703.e7.

+ Open protocol

+ Expand

Generation of Stable Dox-inducible SOD1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate lentiviruses, SOD1 plasmid DNA was transfected along with packaging plasmids psPAX2 (Addgene, Cat# 12260), and pMD2.G (Addgene, Cat# 12259) into HEK293T cells using Fugene 6 (Promega, Cat# E2691). Viral supernatant was collected at 48 and 72 h after transfection and mouse lung cancer cells were transiently infected twice in the presence of 8 μg/ml polybrene (Sigma). Transfected cells were selected with 50 μg/ml G418 (Thermo Fisher Scientific, Cat# 10131035) at 48 h after viral infection for 2 weeks. To generate stable Dox-inducible NoLS-Sod1 cells, mouse lung cancer cells were cotransfected with pSBtet-NoLS-Sod1-Flag and the Sleeping Beauty transposase plasmid pCMV(CAT)T7-SB100 (Addgene, Cat# 34879) using PolyFect (Qiagen), followed by selection with 10 µg/ml blasticidin for 7 days.

Wang X., Zhang H., Sapio R., Yang J., Wong J., Zhang X., Guo J.Y., Pine S., Van Remmen H., Li H., White E., Liu C., Kiledjian M., Pestov D.G, & Steven Zheng X.F. (2021). SOD1 regulates ribosome biogenesis in KRAS mutant non-small cell lung cancer. Nature Communications, 12, 2259.

+ Open protocol

+ Expand

ACBD3 and Dexras1 Interaction Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

GST or GST-tagged ACBD3 constructs were cotransfected with Dexras1-Myc constructs into HEK293T cells using PolyFect (Qiagen, Valencia, CA), with a transfection efficiency of greater than 90%. Cells were lysed 48 hr after transfection in buffer A (100 mM Tris [pH 7.4], 150 mM NaCl, 1% Triton X-100, 15% glycerol, 1 mM PMSF, 25 mg/ml antipain, 50 mg/ml leupeptin, 50 mg/ml aprotinin, 25 mg/ml chymostatin, and 25 mg/ml pepstatin). Lysates were precleared with pansorbin cells (Calbiochem, Billerica, MA), then 1 mg of total protein was incubated with Glutathione-Sepharose beads overnight at 4 C. Beads were washed with wash buffer (50 mM Tris [pH 7.4], 500 mM NaCl, 10 mM b-glycerophosphate) twice, then once with buffer A. Beads were quenched in sample buffer (100 mM Tris [pH 6.8], 10% glycerol, 250 mM b-mercaptoethanol, 2% sodium dodecyl sulfate, and bromophenol blue). Total protein (50 mg) was loaded as input. Rhes-Myc binding was examined using an anti-myc antibody (EMD Millipore, Billerica, MA) followed by incubation with anti-mouse secondary conjugated to horseradish peroxidase (HRP) (Jackson Immunoresearch Laboratories, West Grove, PA); blots were then stripped and probed with an anti-GST antibody conjugated to HRP to detect ACBD3. Pierce Chemiluminescence (Life Technologies, Grand Island, NY) was used to detect bands on the Western blot.

Chen Y., Mathias L., Falero Perez J.M, & Kim S.F. (2015). PKA-mediated phosphorylation of Dexras1 suppresses iron trafficking by inhibiting S-nitrosylation. FEBS letters, 589(20 0 0), 3212-3219.

+ Open protocol

+ Expand

Transient Transfection of HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 cells were cultivated in DMEM (GE Healthcare, Little Chalfont, UK), supplemented with 10% foetal calf serum (FCS) (LifeTechologies, Carlsbad, CA, USA), antibiotics (penicillin, 100 U/mL and streptomycin, 100 μg/mL; GE Healthcare, Chalfont St Giles, UK). HEK293 cells were transiently-transfected using Polyfect (Qiagen Inc., Valencia, CA, USA) according to the instructions supplied by the manufacturer and harvested 36 h after transfection.

Müller A.C., Giambruno R., Weißer J., Májek P., Hofer A., Bigenzahn J.W., Superti-Furga G., Jessen H.J, & Bennett K.L. (2016). Identifying Kinase Substrates via a Heavy ATP Kinase Assay and Quantitative Mass Spectrometry. Scientific Reports, 6, 28107.

+ Open protocol

+ Expand

Oncogenic H-Ras and PHD Overexpression in U2OS Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

U2OS cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% FBS and 25 mM glucose. Mammalian expressing pcDNA3-H-ras^V12 and pcDNA3-H-ras^wt were gifted from Julian Downward (Addgene plasmid #39504 and #39503)42 (link). Flag-tagged PHD1 (Addgene plasmid #36950), PHD2 (Addgene plasmid #36949) and PHD3 (Addgene plasmid #36951) lentiviral vectors were gifted from William Kaelin. HA-tagged PHD2 was provided from Jong-Wan Park (Seoul National University). Flag-tagged catalytic domain of PHD2 (181–426) was generated using a PCR-based mutagenesis with BamHI and NotI enzyme site contained specific oligonucleotides (Sense, 5′-AACGGGCAGACGAAGCCCCTG-3′; antisense, 5′-CTAGAAGACGTCTTTACCGACCGA-3′). Site-specific mutations of PHD2 (C283S, C302S, C323S, and C326S) were generated by PCR-based point mutagenesis (Stratagene). Mammalian expressing plasmids were transfected into U2OS cells using PolyFect (Qiagen) according to the manufacturer’s instructions. To generate stable cell lines, pcDNA3-H-ras^V12- and pcDNA3-H-ras^wt-transfected U2OS cells were incubated for 48 h, and were then cultured for 2 weeks with 700 μg/mL of G418.

Lee G., Won H.S., Lee Y.M., Choi J.W., Oh T.I., Jang J.H., Choi D.K., Lim B.O., Kim Y.J., Park J.W., Puigserver P, & Lim J.H. (2016). Oxidative Dimerization of PHD2 is Responsible for its Inactivation and Contributes to Metabolic Reprogramming via HIF-1α Activation. Scientific Reports, 6, 18928.

+ Open protocol

+ Expand

FOXO1 interacts with HTTCAG47 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells were transfected with or without FOXO1 using Polyfect (Qiagen). Cells were lysed 48 h post-transfection in Buffer D (20 mM Tris pH7,9, 20% glycerol, 0,1MKCl, 0,2 mM EDTA, 0,5 mM DTT, protease inhibitor, RNase inhibitor) by sonication. Biotinylated HTT^CAG47 mRNA was generated by PCR-amplification of HTT-exon1 using primers with a T7 site in the forward primer (CCAAGCTTCTAATACGACTCACTATAGGGAGAATGGCGGACCCTGGAAAAGCTCATGAAGG and GGTCGGTGCAGCGGCTCCTCAGC) and in vitro transcription using the T7 RiboMAX Kit (Promega). Purified transcripts were then coated onto Streptavidin–Agarose beads (SIGMA) and incubated with cell lysates. After washing the beads with Buffer D, RNA-bound proteins were analysed by mass spec at the UMCG. Mass spec analysis was done on three biological repeats.

Furtado G.V., Yang J., Wu D., Papagiannopoulos C.I., Terpstra H.M., Kuiper E.F., Krauss S., Zhu W.G., Kampinga H.H, & Bergink S. (2021). FOXO1 controls protein synthesis and transcript abundance of mutant polyglutamine proteins, preventing protein aggregation. Human Molecular Genetics, 30(11), 996-1005.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!