Log In Sign up
The largest database of trusted experimental protocols

Hi seq 50 bp single end sequencing

Manufactured by Illumina
Visit Supplier

The HiSeq 50-bp single-end sequencing is a laboratory equipment product that provides high-throughput DNA sequencing capabilities. It generates 50-base pair single-end reads, which are fundamental units of sequencing data.

Automatically generated - may contain errors

Lab products found in correlation

Kod hot start dna polymerase, by Merck Group (4 mentions) Dneasy blood tissue kit, by Qiagen (4 mentions) Ampure xp bead, by Beckman Coulter (4 mentions)

4 protocols using hi seq 50 bp single end sequencing

1

NGS library preparation from genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted by using the DNeasy Blood & Tissue Kits (Qiagen 69506). Primary PCR was performed by using the KOD Hot Start DNA Polymerase (Millipore 71086) and the following pair of Nextera NGS primers (Nextera NGS-F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGttgtggaaaggacgaaacaccg; Nextera NGS-R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGccactttttcaagttgataacgg). Primary PCR products were purified using the AMPure XP beads (Beckman A63881). A second PCR was performed to add adaptors and indexes to each sample. Hi-Seq 50-bp single-end sequencing (Illumina) was performed.
Wei J., Long L., Zheng W., Dhungana Y., Lim S.A., Guy C., Wang Y., Wang Y.D., Qian C., Xu B., Anil K., Saravia J., Huang H., Yu J., Doench J.G., Geiger T.L, & Chi H. (2019). Targeting Regnase-1 programs long-lived effector T cells for cancer therapy. Nature, 576(7787), 471-476.
+ Open protocol
+ Expand
2

Genomic DNA Extraction and NGS Library Prep

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted by using the DNeasy Blood & Tissue Kits (Qiagen 69506). Primary PCR was performed by using the KOD Hot Start DNA Polymerase (Millipore 71086) and the following pair of Nextera NGS primers:
Nextera NGS-F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTGTGGAAAGGACGAAACACCG; Nextera NGS-R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCACTTTTTCAAGTTGATAACGG. Primary PCR products were purified using the AMPure XP beads (Beckman A63881). A second PCR was performed to add adaptors and indexes to each sample. Hi-Seq 50-bp single-end sequencing (Illumina) was performed.
Fu G., Guy C.S., Chapman N.M., Palacios G., Wei J., Zhou P., Long L., Wang Y.D., Qian C., Dhungana Y., Huang H., KC A., Shi H., Rankin S., Brown S.A., Johnson A., Wakefield R., Robinson C.G., Liu X., Sheyn A., Yu J., Jackowski S, & Chi H. (2021). Metabolic control of Tfh cells and humoral immunity by phosphatidylethanolamine. Nature, 595(7869), 724-729.
+ Open protocol
+ Expand
3

NGS library preparation from genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted by using the DNeasy Blood & Tissue Kits (Qiagen 69506). Primary PCR was performed by using the KOD Hot Start DNA Polymerase (Millipore 71086) and the following pair of Nextera NGS primers (Nextera NGS-F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGttgtggaaaggacgaaacaccg; Nextera NGS-R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGccactttttcaagttgataacgg). Primary PCR products were purified using the AMPure XP beads (Beckman A63881). A second PCR was performed to add adaptors and indexes to each sample. Hi-Seq 50-bp single-end sequencing (Illumina) was performed.
Wei J., Long L., Zheng W., Dhungana Y., Lim S.A., Guy C., Wang Y., Wang Y.D., Qian C., Xu B., Anil K., Saravia J., Huang H., Yu J., Doench J.G., Geiger T.L, & Chi H. (2019). Targeting Regnase-1 programs long-lived effector T cells for cancer therapy. Nature, 576(7787), 471-476.
+ Open protocol
+ Expand
4

Genome-wide Screening of mTORC1 Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted by using the DNeasy Blood & Tissue Kits (69506; Qiagen). Primary PCR was performed by using the KOD Hot Start DNA Polymerase (71086; Millipore) and the following pair of Nextera NGS primers (Nextera NGS-F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTGTGGAAAGGACGAAACACCG; Nextera NGS-R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCACTTTTTCAAGTTGATAACGG). Primary PCR products were purified using the AMPure XP beads (A63881; Beckman). A second PCR was performed to add adaptors and indexes to each sample. Hi-Seq 50-bp single-end sequencing (Illumina) was performed. To minimize false positive candidates, deep sequencing data were analyzed by two independent pipelines as detailed below. We superimposed the top-enriched genes (550 positive and 300 negative mTORC1 regulators) consistently captured by these two independent computational analyses and applied additional filters [∣z-score∣ > 1.96; ∣log2 fold change (FC) (p-S6hi/p-S6lo)∣ > 0.5; and log2 FC (p-S6lo/input) > 0.2 for positive regulator or log2 FC (p-S6hi/input) > 0.2 for negative regulator], resulting in the identification of a total of 292 positive and 125 negative mTORC1 regulators.
Long L., Wei J., Ah Lim S., Raynor J.L., Shi H., Connelly J.P., Wang H., Guy C., Xie B., Chapman N.M., Fu G., Wang Y., Huang H., Su W., Saravia J., Risch I., Wang Y.D., Li Y., Niu M., Dhungana Y., KC A., Zhou P., Vogel P., Yu J., Pruett-Miller S.M., Peng J, & Chi H. (2021). CRISPR screens unveil signal hubs for nutrient licensing of T cell immunity. Nature, 600(7888), 308-313.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!