RNA encapsulated in EVs was collected using the second part of the exoRNeasy serum/plasma kit, RNA from immunoprecipitated EAgo-1 was extracted with the miRNeasy Serum/Plasma Kit (Qiagen) and a separate miRNA-enriched fraction could be purified from the cellular fraction with the miRNeasy Mini kit and RNeasy MinElute Cleanup kit (Qiagen), all according to the manufacturer’s protocol. Quality and concentration of the resulting RNA samples were measured on a Nanodrop spectrophotometer (NanoPhotometer N60, Implen) and analysed using the Agilent Bioanalyzer Small RNA chip (Agilent Technologies, Inc.). Equal amounts of RNA (20 ng for EAgo-1 immunoprecipited RNA and 100 ng for EV encapsulated RNA) were used for cDNA synthesis using the qScriptTM microRNA cDNA Synthesis Kit (Quanta Bio) following the manufacturer’s protocol. This protocol includes polyadenylation of the miRNAs in a poly(A) polymerase reaction followed by cDNA synthesis using an oligo-dT adapter primer. This adapter primer allows amplification of cDNAs in quantitative real-time PCR (qRT-PCR) reactions due to a unique sequence at its 5′ end. The obtained cDNA was then diluted ten-fold with Milli-Q water (Millipore).
Qscript microrna cdna synthesis kit
Manufactured by Quantabio
Sourced in United States, United Kingdom
The QScript microRNA cDNA Synthesis Kit is a laboratory equipment product designed for the reverse transcription of microRNA (miRNA) into complementary DNA (cDNA). The kit provides necessary reagents and protocols for the efficient conversion of miRNA into cDNA, which can then be used for downstream applications such as quantitative PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Miscript sybr green pcr kit, by Qiagen (8 mentions)
Perfecta sybr green supermix, by Quantabio (8 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Mirneasy mini kit, by Qiagen (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Sybr green, by Takara Bio (3 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Milli q water, by Merck Group (2 mentions)
Perfecta sybr green fastmix rox, by Quantabio (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time detection system, by Bio-Rad (2 mentions)
Iq sybr green supermix, by Bio-Rad (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Mirneasy micro kit, by Qiagen (2 mentions)
Trizol, by Merck Group (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
37 protocols using qscript microrna cdna synthesis kit
1
miRNA Extraction and Quantification Protocol
2
Quantification of Insect miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Equal volumes of the RNA samples (7 µl for each) were used for cDNA synthesis using the qScriptTM microRNA cDNA synthesis kit (QuantaBio) following manufacturer's protocol, as previously described (Van den Brande et al., 2018 (link)). First, a poly(A) polymerase reaction was performed for the polyadenylation of the miRNAs, followed by cDNA synthesis using an oligo-dT adapter primer. The obtained cDNA was diluted ten-fold with Milli-Q water (Millipore). Amplification of cDNA samples was performed using a microRNA-specific forward and a universal poly(T) adapter reverse primer (Table S1 ). Based on their high abundance in hemolymph serum (highlighted in Table S2 ), as well as on their available characterization in literature (Belles, 2017 (link); He et al., 2016 (link)), we selected miR-276, let-7 and bantam for qRT-PCR. Primer pairs were previously validated by designing relative standard curves with serial dilutions of appropriate hemolymph serum derived cDNA samples. All qRT-PCR reactions were performed in duplicate in 96-well plates on the QuantStudioTM 3 System (ThermoFisher). Each reaction contained 5 µl of PerfeCTa SYBR Green Fastmix, ROX (QuantaBio), 0.5 µl of each forward and reverse primer (10 µM), 1.5 µl of Milli-Q water and 2.5 µl of cDNA. The following thermal cycling profile was used: 95°C for 20 s, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s.
3
Quantitative Analysis of RNA Expression in Cellular Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted using TRIzol reagent (Hualan, Shanghai, China). RNA quality and concentration were analyzed using NanoDrop 1000 (NanoDrop Technologies, Wilmington, USA). Then total RNAs were reversely transcribed into cDNA using qScript microRNA cDNA synthesis kit (Quantabio, Beverly, MA, USA), and qRT-PCR reactions were conducted on the 7500 real-time PCR system. GAPDH and U6 were selected as the endogenous controls. The relative levels of TINCR, miR-19b-3p, ERK2, and NF-κB were calculated using the 2−ΔΔCt method [27 (link)]. The primer sequences are listed in Table 1 .
The primer sequences used in RT-qPCR
| Gene name | Forward primers (5ʹ-3ʹ) | Reverse primers (5ʹ-3ʹ) |
|---|---|---|
| TINCR | CTAAATTACCTGGCCGCAG | CGCCTGAATTCCAAAGG |
| MiR-19b-3p | CTGGATGTGGAGCCATTGT | GTCCTTTCACCTGGGGCCGG |
| ERK-2 | TGTGGTCCTCCCTCCTCS | CGCCTTCTCTCCGATGT |
| GAPDH | CGAGAGGATCCGCCGACAT | TTGTGCCATACAGCGTTGAC |
| U6 | GACAGAATCGGTCTGTTGCAC | GATTACCCGTCCGCAATCGATC |
4
SARS-CoV-2 RNA Isolation and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolation from SARS-CoV-2 infected and control cells was
performed as described above. According to the manufacturer’s
instructions, RNA was reverse transcribed to cDNA using the qScript
microRNA cDNA synthesis kit (Quantabio, Lutterworth, UK), and selected
miRs were assessed by qPCR using the PerfeCTa SYBR Green SuperMix
(Quantabio, Anatolia GeneWorks Istanbul, Turkey). RNU6 was used as
a normalization reference RNA using the comparative cycle threshold
method.43 (link) Primers for each miR assessed
included hsa-miR-8066, -5197, -3611, -3934-3p, -1307-3p, -3691-3p,
and -1468-5p (Table 3 ; Sentromer DNA Technologies, Istanbul, Turkey). The following thermocycling
conditions were used: denaturation at 95 °C for 2 min, then 40
cycles of 95 °C for 2 s, 60 °C for 15 s, and extension at
72 °C for 15 s.
performed as described above. According to the manufacturer’s
instructions, RNA was reverse transcribed to cDNA using the qScript
microRNA cDNA synthesis kit (Quantabio, Lutterworth, UK), and selected
miRs were assessed by qPCR using the PerfeCTa SYBR Green SuperMix
(Quantabio, Anatolia GeneWorks Istanbul, Turkey). RNU6 was used as
a normalization reference RNA using the comparative cycle threshold
method.43 (link) Primers for each miR assessed
included hsa-miR-8066, -5197, -3611, -3934-3p, -1307-3p, -3691-3p,
and -1468-5p (
conditions were used: denaturation at 95 °C for 2 min, then 40
cycles of 95 °C for 2 s, 60 °C for 15 s, and extension at
72 °C for 15 s.
5
Circulating miRNA Isolation and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Circulating miRNA was isolated from 300 µL of plasma using NucleoSpin miRNA Plasma (Macherey-Nagel, Germany) following the manufacturer’s protocol. Before isolation 25 fm of synthetic miR-39 from C. elegans miRNA (Institute of Biochemistry and Biophysics, Polish Academy of Sciences) was added to each sample. qScript microRNA cDNA Synthesis Kit (Quantabio, MA, USA) was used for first strand cDNA synthesis; we used 4 µL of each sample for cDNA synthesis. miRNA expression was assessed using qPCR performed with Bio-Rad CFX96 Real-Time Detection System (Bio-Rad, CA, USA). Reaction solution was as follows: 1 µL of cDNA sample, iQ SYBR Green Supermix (Bio-Rad, CA, USA), Universal Primer from qScript micrRNA Synthesis Kit, specific forward primer for analyzed miRNA. Quantification of the target miRNA expression value was expressed as 2∆Ct and NormFinder algorithm was used to find the best reference gene. Ct results were normalized to spike-in C. elegans miRNA and miR-223-5p.
6
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA from tissues and cells was performed using Ribozol reagent (Invitrogen, USA). AMV Reverse Transcriptase XL (Clontech, USA) and QuantiTect SYBR Green PCR Kit (Qiagen, Shanghai, China) were used to prepare reverse transcription and qPCR reaction, respectively. With 18S rRNA as endogenous control, the expression level of PLAC2 was normalized. With GAPDH as endogenous control, PTEN expression level (a target of miR-21) was normalized.
To detect miRNA-21, mirVana miRNA Isolation Kit (Thermo Fisher Scientific), qScript microRNA cDNA Synthesis Kit (Quantabio, USA) and miScript SYBR Green PCR Kit (QIAGEN, Germany) were used to perform miRNA extractions, miRNA reverse transcriptions and qPCR reactions, respectively. U6 was used as the endogenous control of miRNA-21. Three replicates were set for each experiment, and 2-ΔΔCT method was used to process data.
To detect miRNA-21, mirVana miRNA Isolation Kit (Thermo Fisher Scientific), qScript microRNA cDNA Synthesis Kit (Quantabio, USA) and miScript SYBR Green PCR Kit (QIAGEN, Germany) were used to perform miRNA extractions, miRNA reverse transcriptions and qPCR reactions, respectively. U6 was used as the endogenous control of miRNA-21. Three replicates were set for each experiment, and 2-ΔΔCT method was used to process data.
7
MicroRNA Expression Quantification by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fifty nanograms of total RNA were reverse-transcribed using the qScript microRNA cDNA Synthesis Kit (QuantaBio) according to manufacturer instructions. Samples were analyzed through qRT-PCR using the PerfeCTa SYBR® Green SuperMix (QuantaBio) in a CFX-96 thermal cycler (Bio-Rad Laboratories) according to manufacturer instructions. All reactions were run in duplicate in a 25µL reaction. MiRNA primers were purchased from Metabion International AG (Metabion) or Sigma-Aldrich (Merck KGaA). MiR-486 was used as an endogenous normalizer. Expression levels were calculated using the 2−ΔΔCt formula.
8
Quantifying Serum miR-122 and TNF-α
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Trizol. miRs and RNAs were
converted to cDNA using the qScript microRNA cDNA Synthesis Kit (Quanta
bio). qPCR for miR-122 and TNF-α was performed using the SYBR
Green RT-qPCR Kit, and 18S rRNA was used as an internal control. Serum
miR levels were quantified using a constant amount of serum (200 μL).
converted to cDNA using the qScript microRNA cDNA Synthesis Kit (Quanta
bio). qPCR for miR-122 and TNF-α was performed using the SYBR
Green RT-qPCR Kit, and 18S rRNA was used as an internal control. Serum
miR levels were quantified using a constant amount of serum (200 μL).
9
Quantifying lncRNA MIR100HG and miR-204-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect the expression of lncRNA MIR100HG, total RNA was extracted using Trizol reagent (Invitrogen, USA), Applied Biosystems™ High-Capacity cDNA Reverse Transcription Kit was used to perform in vitro transcription, and PCR reaction systems were prepared using SYBR® Green Real-Time PCR Master Mixes (Thermo Fisher Scientific, USA). To detect the expression of miR-204-5p, miRNAs were extracted using miRNeasy Mini Kit (QIAGEN), reverse transcription and performed using qScript microRNA cDNA Synthesis Kit (Quantabio) and PCR reaction systems were prepared using miScript SYBR Green PCR Kit (QIAGEN). Primers of lncRNA MIR100HG, miR-204-5p, as well as endogenous controls GAPDH and U6 were designed and synthesized by Sangon (Shanghai, China). Data normalizations were performed using 2−ΔΔCT method. Expression of lncRNA MIR100HG was normalized to GAPDH and expression of miR-204-5p, was normalized to U6. It is worth noting that we detected mature miRNA after adding poly A. The forward primer was: 5ʹ-TCGTCCCTTTGCCTTCCCAGC-5ʹ (reverse complementary sequence of miR-204-5p) and reverse primer was poly T.
10
Tick Salivary Gland and Gut miRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Individual fed uninfected or A. phagocytophilum-infected nymphal tick salivary glands or whole guts were dissected in sterile 1x phosphate buffer saline. One set of these samples was processed for homogenization in lysis buffer (Aurum Total RNA kit, Bio-Rad) for RNA extractions following manufacturer’s recommendation. The other set was pooled for isolation of miRNA using PureLink miRNA isolation kit (ThermoFisher Scientific). The extracted RNA or miRNA was processed for cDNA synthesis using iSCRIPT cDNA synthesis kit (BioRad) or qScript microRNA cDNA Synthesis Kit (QuantaBio, VWR). QRT-PCR was performed with these cDNAs to quantify miR-133 or isoatp4056 expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!