Lipofectamine reagent

Manufactured by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Australia, Japan, Canada, Germany, France, Italy

Lipofectamine reagent is a transfection agent used for the delivery of nucleic acids, such as DNA or RNA, into mammalian cells. It facilitates the uptake of these molecules by the cells, enabling efficient gene expression or gene silencing studies.

Automatically generated - may contain errors

Lab products found in correlation

569 protocols using lipofectamine reagent

Quantitative Analysis of Neomycin-Resistant Colonies

Check if the same lab product or an alternative is used in the 5 most similar protocols

Five hundred thousand HeLa cells or U2OS cells were seeded in T75 flasks. Cells were transfected next day using Lipofectamine reagent (Life Technologies) following the manufacturer's protocol with 0.1 μg of pIRES2-EGFP and 0.8ug of indicated constructs. The plasmids were mixed with 12 ul of Plus reagent (Life Technologies) in 180 ul serum free media. Then 85 ul of serum free media was mixed with 15 ul Lipofectamine reagent (Life Technologies) before being added into the previous DNA mix. The transfection cocktail was added to the cells in 6 ml of serum free media for 3 h, after which it was replaced with 9 ml of Minimum Essential Media (MEM). Cells were maintained under selective medium containing 500μg/ml G418 (Life Technologies) for 14 days starting 48 h post transfection before being fixed and stained with crystal violet solution (0.2% crystal violet in 5% acetic acid and 2.5% isopropanol). Selective medium was changed every 3 days. The number of Neomycin-resistant colonies were counted in each flask. Statistical analysis was performed using unpaired two sample t test compared with control.

Du Q., Stow E.C., LaCoste D., Freeman B., Baddoo M., Shareef A.M., Miller K.M, & Belancio V.P. (2023). A novel role of TRIM28 B box domain in L1 retrotransposition and ORF2p-mediated cDNA synthesis. Nucleic Acids Research, 51(9), 4429-4450.

+ Open protocol

+ Expand

Modulating DC-SIGN and TLR4 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Negative control (NC) or DC-SIGN-specific siRNA (100 nM/10⁵ cells) was transfected into macrophages using Lipofectamine reagent (Invitrogen).
The full-length DC-SIGN (1212 bp) and TLR4 (2520 bp) were cloned into pFLAG-CMV-5.1 and pcDNA3.1 (−)/myc-HisA plasmids, respectively, to overexpress FLAG-DC-SIGN and His-TLR4. Transient transfection of HEK293 cells with either pFLAG-CMV-5.1-DC-SIGN or pcDNA3.1 (−)/myc-HisA-TLR4 plasmids (25 μg/10⁵ cells) was performed using Lipofectamine reagent (Invitrogen).

Yang K., Liu X., Liu Y., Wang X., Cao L., Zhang X., Xu C., Shen W, & Zhou T. (2017). DC-SIGN and Toll-like receptor 4 mediate oxidized low-density lipoprotein-induced inflammatory responses in macrophages. Scientific Reports, 7, 3296.

+ Open protocol

+ Expand

CRISPR-Mediated TGFBI Gene Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transfections were performed in 24-well cell culture plates with confluencies of approximately 60–70% using 1.5 μg of the TGFBI-targeting sgRNA (TCAGCTGTACACGGACCGCACGG) plasmid, 1 μg of the Cas9 plasmid, and 10 μl of Lipofectamine Reagent (Invitrogen, Carlsbad, CA), or negative control using only 1 μg of the Cas9 plasmid, and 10 μl of Lipofectamine Reagent, according to the manufacturer’s instructions. Transfected cells were cultured for 24 h; these were then harvested, diluted in cell culture medium to approximately 1 cell/100 μl, and re-plated in 96-well cell culture plates. Once individual colonies were apparent in 66 of two 96-well plate, these were cultured in separate wells of 24-well plates and, subsequently, further expanded in 6-well and 60 mm plates until cell numbers were sufficient for genomic DNA extraction and western blot analyses.

Kim E.K., Kim S, & Maeng Y.S. (2019). Generation of TGFBI knockout ABCG2+/ABCB5+ double-positive limbal epithelial stem cells by CRISPR/Cas9-mediated genome editing. PLoS ONE, 14(2), e0211864.

+ Open protocol

+ Expand

Lentiviral Vector Construction for ROCK1 Expression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

ROCK1 coding sequence was cloned into the pLVX-Puro vector for constructing pLVX-Puro-ROCK1 expressing vector. The primers were as follow: ROCK1-F 5 0 -GCGAATTCATG TCGACTGGGGACAGTTTTG-3 0 and ROCK1-R 5 0 -CGGGATCCA CTAGTTTTTCCAGATGTATTT-3 0 . 293T cells were plated in 6well plates and transfected with 1 ng blank pLVX-Puro or pLVX-Puro-ROCK1 vector, 0.1 ng psPAX2 and 0.9 ng pMD2G for 4-6 using Lipofectamine reagent (Invitrogen, Carlsbad, CA) according to the instruction of the manufacturer. The specific shRNA sequence which targets ROCK1 coding sequence were cloned into the pLKO.1-puro lentiviral vector. The sequences of shRNA were as follow: ROCK1-shRNA-1 (point 745-767), AGGCGGTGATGGCTATTAT; ROCK1-shRNA-2 (point 2762-2784), AGAAACTCTTTCGACTCAG; ROCK1-shRNA-3 (point 3777-3799), GATATAGAAGTGGAACCAG. 293T cells were plated in 6-well plates and transfected with 1 ng pLKO.1-puro-scramble shRNA or pLKO.1-puro-ROCK1-shRNA vector, 0.9 ng psPAX2 and 0.1 ng pMD2G for 4-6 h using Lipofectamine reagent (Invitrogen, Carlsbad, CA) according to the instruction of the manufacturer. After transfection, the free-serum medium was moved and cells were cultured in complete medium. Viruses were collected 48 h post-transfection and infected OVX-rBMSCs or osteoblasts. The blank pLVX-Puro vector and pLKO.1-puro-scramble shRNA was used as negative control.

Guo X., Wei S., Lu M., Shao Z., Lu J., Xia L., Lin K, & Zou D. (2018). RNA-Seq investigation and in vivo study the effect of strontium ranelate on ovariectomized rat via the involvement of ROCK1. Artificial cells, nanomedicine, and biotechnology, 46(sup1).

+ Open protocol

+ Expand

Transient Transfection Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Approx. 5 × 10⁵ cells were plated on 60 mm plates. Transient transfections were performed with 5 μg of expression vector using the LipofectAMINE Reagent (Life Technologies, Inc). After 4 h incubation, the OptiMEM media was replaced with the complete media and the cells were grown for 48 h after transfection. The transfection was also performed in other formats, e.g., 6 well plates and 96 well plates by varying the cell number and amount of plasmid DNA according to the surface area.

Kaur S., Nag A., Gangenahalli G, & Sharma K. (2019). Peroxisome Proliferator Activated Receptor Gamma Sensitizes Non-small Cell Lung Carcinoma to Gamma Irradiation Induced Apoptosis. Frontiers in Genetics, 10, 554.

+ Open protocol

+ Expand

Transient Transfection Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were split by using brief trypsin treatment one day before the experiment and allowed to grow to ∼75% confluency. Cells were transfected using Lipofectamine reagent (Life Technologies) according to the manufacturer's protocol. To avoid the formation of protein aggregates due to overexpression, cells were incubated for less than 16 hours after the initiation of the transfection. Lack of fluorescent aggregates in cells was confirmed by fluorescence microscopy.

Zhang F., Patel D.M., Colavita K., Rodionova I., Buckley B., Scott D., Kumar A., Shabalina S.A., Saha S., Chernov M., Osterman A, & Kashina A. (2015). Arginylation regulates purine nucleotide biosynthesis by enhancing the activity of phosphoribosyl pyrophosphate synthase. Nature communications, 6, 7517.

+ Open protocol

+ Expand

Targeted gene depletion via siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Targeted genes were depleted by transient transfection of siRNA directed against BRCA2 (5′-GAAGAAUGCAGGUUUAAUAdTdT-3′), ERCC4 (ERCC4-5), or ERCC6 (ERCC6-2). All siRNA duplexes were from Qiagen. siRNA duplexes were transfected at a final concentration of 100 nmol/L using the Lipofectamine Reagent (Life Technologies) according to the manufacturer’s recommendations. In all experiments, a fraction of transfected cells was analyzed by immunoblot to assess knockdown efficiency. Trans-fection of plasmid cDNA was achieved using Lipofectamine LTX (Life Technologies). Functional assays were performed 48 hours after transfection, and protein expression was concurrently analyzed by immunoblot.

Ceccaldi R., O'Connor K.W., Mouw K.W., Li A.Y., Matulonis U.A., D'Andrea A.D, & Konstantinopoulos P.A. (2015). A Unique Subset of Epithelial Ovarian Cancers with Platinum Sensitivity and PARP Inhibitor Resistance. Cancer research, 75(4), 628-634.

+ Open protocol

+ Expand

Transient Transfection Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Screening Glucocorticoid Receptor Antagonists

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 4

[Figure (not displayed)]

COS-7 cells (ATCC, Manassas, Va.) were plated in 24 well plates in DME+5% csFBS without phenol red at 70,000 cells/well. Once the cells attached to the plates (typically after overnight incubation after plating), they were transfected in OPTIMEM medium (Life Technologies) using lipofectamine reagent (Life Technologies) with 0.25 μg GRE-LUC, 25 ng pCR3.1 GR, and 10 ng CMV-renilla LUC per well. Twenty-four hours after transfection, the cells were fed with DME+5% csFBS without phenol red (Fisher Scientific, Waltham, Mass.) and treated with the test compounds (1 μM to 10 μM dose range) in the presence of 0.1 nM dexamethasone (Sigma, St. Louis, Mo.). Sixteen to twenty-four hours after treatment, a luciferase assay was performed using the Dual Luciferase assay kit (Promega, Madison, Wis.). Firefly luciferase values were normalized to Renilla luciferase numbers.

Results of compound testing in the GR antagonist assay are presented in Table 3. RU486 (Sigma, St. Louis, Mo.), used as a positive control in the antagonist assay, had a mean IC₅₀of 3.8 nM (n=2), determined by non-linear regression and three point logistics fitting.

TABLE 3

Test compound activity in GR antagonist assay

CompoundGR Antagonist

No.IC₅₀(μM)

15>10.0

16>10.0

US11034669B2. Pyrrole and pyrazole compounds and methods of use thereof (2021-06-15). Nuvation Bio Inc. [US]. Inventors: Sarvajit Chakravarty [US], Son Minh Pham [US], Jiyun Chen [US], Jayakanth Kankanala [US], Jeremy D. Pettigrew [CA], Anjan Kumar Nayak [IN], Anup Barde [IN], Brahmam Pujala [IN].

+ Open protocol

+ Expand

Overexpression and Silencing of NF-κB p65 in ES-2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length human RelA cDNA was amplified by PCR from pCMV4-RelA plasmid (Addgene,
China) using forward primer 5′-GGTCGGTACCATGGACGAACTGTTCCCCCT-3′ and reverse primer
5′-CCATCTCGAGTTAGGAGCTGATCTGACTCA-3′, inserted into pcDNA3.1
vector (Invitrogen, China) tagged with FLAG. P65 siRNA, MMP-9 siRNA and its control
siRNA was purchased from Santa Cruz Biotechnology (China). Transient transfection of
ES-2 cells with pcDNA3.1/p65 cDNA or control pcDNA3.1, P65 siRNA, MMP-9 siRNA and its
control siRNA was carried out using the LipofectAmine reagent (Life Technologies,
China) according to the manufacturer's instructions.

Huang X., Teng Y., Yang H, & Ma J. (2016). Propofol inhibits invasion and growth of ovarian cancer cells via regulating miR-9/NF-κB signal. Brazilian Journal of Medical and Biological Research, 49(12), e5717.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!