Miridian mirna mimics

CD4⁺ T cells were transfected on day 1 of culture with luciferase reporter constructs and/or 500nM miRIDIAN miRNA mimics (Dharmacon) using the Neon Transfection System (Thermo Fisher Scientific). Luciferase activity was measured 24 h after transfection with the Dual Luciferase Reporter Assay System (Promega) and a FLUOstar Optima plate-reader (BMG Labtech). The near full-length 3′UTRs of Il7r, Cd28, and Adrb2 were cloned into the psiCHECK-2 luciferase reporter construct (Promega). Primers for cloning and site-directed-mutagenesis (SDM) were: Il7r F: CAGGCTCGAGATTATAAGAAAACCCTTCCATCGACAACC, Il7r R: GATGCGGCCGCTTCCAGAAA ATAGCGCATGCTTGTATTTG; Cd28 F: TAGCTCGAGCAGGGACCCCTATCCAGAAG, Cd28 R: CTAGCGGCCGCAGTCAATGAAT AAATATTTATTGCAGGCTAAGC; Adrb2 F: CAGCTCGAGAGGCTTTCTACTCTCTAAGACCC, Adrb2 R: CAGGCGGCCGCCCAC TCATCGGTCACGACAC. SDM was performed using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) using primers: Il7r SDM F: GATAACCACAACAGTCCTGAATGCTTGATTATATTCTCAGG, Il7r SDM R: CCTGAGAATATAATCAAGCATTCAGGA CTGTTGTGGTTATC; Cd28 SDM F: GAAAACTATGTCACTTGTCCTGATTATTGTAAGAGTCTAAGAAC, Cd28 SDM R: GAAAACTATG TCACTTGTCCTGATTATTGTAAGAGTCTAAGAAC; Adrb2 SDM F: GAATGATATATATTGTCCTGGGAAATCCATATCTAAAGGAG AGAG, Adrb2 SDM R: CTCTCTCCTTTAGATATGGATTTCCCAGGACAATATATATCATTC.

Th17-polarized human or mouse primary CD4⁺ T cells were transfected with miRNA mimics, siRNAs or inhibitors at 48 h of cell culture with the Neon Transfection System (Invitrogen) as previously described (41 (link)). miRIDIAN miRNA mimics (Dharmacon) or siGENOME SmartPools (Dharmacon) were used at 500nM and miRCURY LNA microRNA Power family inhibitors (Exiqon) were used at 5μM or 20μM with appropriate controls. MSCV-PGK-hCD25 miRNA sensors for miR-17, miR-18a, miR-92a, and miR-19b (Simpson et al., 2014 (link)) were constructed to express EGFP with four perfectly complementary binding sites for the miRNA of interest in the 3′UTR as previously described (41 (link)). Cells were transduced by spin infection early on day 2 of Th17 cultures and transfected with miRNA mimics or inhibitors later on day 2 of Th17 cultures. hCD25⁺ CD4⁺ T cells were analyzed on day 3.5 for EGFP expression.

CD4⁺ T cells from the spleen and lymph nodes of mice were enriched by Dynabead positive selection (Invitrogen, L3T4). Cells were stimulated with anti-CD3 and anti-CD28, in the presence of exogenous cytokines and neutralizing antibodies for polarization cultures, for 3 days then rested with 20 units/ml recombinant IL-2 (National Cancer Institute) for an additional 2 days (see Supplemental Experimental Procedures for details). For cytokine assays, T cells were restimulated on day 5 of culture for 5 hours with 20nM PMA and 1μM ionomycin. During the final 2.5hrs of restimulation, 5μg/ml brefeldin A was added. For proliferation assays, cells were labeled with 5μM CellTrace Violet (Invitrogen) per manufacturer’s instruction. Transfections with 500nM miRIDIAN miRNA mimics (Dharmacon) or siGENOME SmartPools (Dharmacon) were performed on day 1 and day 4 of culture using the Neon Transfection System (Invitrogen) as previous described (Steiner et al., 2011 (link)) unless otherwise specified. MSCV-PGK-hCD25 miRNA sensors for miR-23a, miR-23b, miR-24, miR-27a and miR-27b were constructed to express a GFP with four perfectly complementary binding sites for the miRNA in the 3′UTR. Cells were transduced on day 2 of ThN cultures by spin infection and hCD25⁺ CD4⁺ T cells analyzed on day 5 for GFP expression as previously described (Steiner et al., 2011 (link)).

All experiments were performed using the Dual-Luciferase Reporter Assay System (Promega) on a dual-injecting SpectraMax L (Molecular Devices) luminometer according to the manufacturer’s protocol. Ratios of Renilla luciferase readings to firefly luciferase readings were averaged for each experiment. Replicates performed on separate days were mean-centered with the readings from the individual days. For target verification reporter assay, 3′UTRs of indicated genes were amplified from the mouse genomic DNA cells using the Zero Blunt TOPO (Invitrogen) vector and sub-cloned into psiCHECK-2 vector (Promega) using the Cold Fusion Cloning Kit (System Biosciences). 3′UTR seed sequences were mutated using the Quickchange Lightning kit (Agilent). For transfection, 8,000 miRNA-deficient Dgcr8−/− mouse ESCs were plated in ESC media onto a 96-well plate pretreated with 0.2% gelatin. The subsequent day, the cells were transfected with miRIDIAN miRNA mimics (Dharmacon) using Dharmafect1 (Dharmacon) at the manufacturer’s recommended concentration of 100 nM. Simultaneously, 200 ng of the psiCHECK-2 construct was transfected into the ESCs using Fugene6 (Roche) transfection reagent according to the manufacturer’s protocol. Transfection of each construct was performed in triplicate in each assay. The cells were lysed 24 hr after transfection, and the luciferase assay was performed.