Ac5 stable2 neo

The following DNA fragments were obtained by PCR. For Rh1-V5-T2A-GFP, GH24720 clone (DGRC) ligated strep-tag and V5-tag (WSHPQFEKGGRGKPIPNPLLG) at 3′ was replaced with the sequence encoding mCherry of Ac5-STABLE2-neo (Addgene; plasmid #32426) to obtain Ac-Rh1-V5-T2A-GFP. This plasmid was digested by SpeI and XhoI and inserted between the SpeI and XhoI sites of pUAST (Drosophila Genomics Resource Center, Bloomington, IN) to construct pP{UAST-Rh1-V5-T2A-GFP}.
For Rh1 TM variants, DNA fragments encoding Rh1 fragment (Met¹-I⁷⁴, Met¹-L¹⁴⁶, or Met¹-V²⁴¹) and Rh1 C-tail-V5 fusion (H³³³-A³⁷³-WSHPQFEKGGRGKPIPNPLLG*) with homologous nucleotide sequences were obtained from the pP{UAST-Rh1-V5-T2A-GFP} by PCR using the following primers: CTCTGAATAGGGAATTGGG­AATTCGCCACCATGGAGAGCTTTG and CAGGCGATATTTCGGATGTATGTAGATCACCACGCCATTTCCG, CTCTGAATAGGGA­ATTGGGAATTCGCCACCATGGAGAGCTTTG and CAGGCGA­-TATTTCGGATGCAGGGAGATCATGCACATGGAC, CTCTGAA­T-­AGGGAATTGGGAATTCGCCACCATGGAGAGCTTTG and CAGGCGATATTTCGGATGGACAGCAGCAATGATGAACCAGTAAG, and CATCCGAAATATCGCCTGGCCC and AAGATCCTCTAGAGGTACCCTTACGTAGAATCGAGACCGAGGAGAGG, respectively. These fragments were inserted between the EcoRI and XhoI sites of pUAST by Gibson assembly to obtain pP{UAST-Rh1-TMx-V5} (x = 1, 123, or 12345). These plasmids were injected into embryos by BestGene (Chino Hills, CA) to generate transgenic lines.