Superscript 2 kit

Total RNA was extracted using TRizol (Invitrogen) followed by treatment with DNAase I (Fermentas) to exclude the genomic DNA before reversal transcription. Complementary DNA (cDNA) was synthesized using the SuperScript II kit (Invitrogen). A volume of 1 μL of cDNA was mixed with Power SYBR Green PCR MasterMix (Applied Biosystem, Carlsbad, CA, USA), and specific primer sets were added to a final concentration of 400 nM in 20 μl of reaction mixture. The reaction was performed on an ABI9700 Machine. Data were analyzed using the Lightcycler software v3.5 (Roche Applied Science, Indianapolis, IN, USA). Each sample was assayed in triplicates. Target mRNA levels were normalized against mouse GAPDH. The primers used are listed in Additional file 1: Table S5.

Total RNA was isolated from inflorescences (Arabidopsis) and petals (rapeseed) using Trizol (Bioteke, Beijing, China) according to the manufacturer’s instructions. DNase treatment was performed on total RNA to remove the genomic DNA contamination, and then the RNA was used for first strand cDNA synthesis using a SuperScript II kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol with an oligo(dT)₁₈ primer. The derived cDNA was used as template for real-time RT-PCR analysis. Quantitative PCR was performed with SYBR Green Realtime PCR Master Mix (TOYOBO, Osaka, Japan). ACTIN mRNA was detected in parallel and controlled data normalization. The primers used for quantitative PCR are listed in Supplementary Table S1.

For extraction of RNA and DNA we used the AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany) following the provider's protocol. Extracted RNA was kept at −80°C and was used for cDNA synthesis using the Superscript II Kit (Invitrogen, Carlsbad, California, USA). For mRNA analysis, specific primers were designed using the Primer3 software and oligonucleotides were purchased from Eurofins MWG (München, Germany). Prior to use, the primers were tested using Human Universal Reference RNA (Stratagene, San Diego, California, USA), which was used as interplate calibrator for the RT-PCR analyses. As reference, expression levels of 18s and ARF1 were initially tested and ARF1 transcript levels were used for the experiments presented in this manuscript using the 2(−DeltaDeltaCt) method. The following primers were used: ITPR1 F: TTCCATCCTAACGGAACGAG; ITPR1 R: CACTCTGTTGCCAAAGCAAG; ITPR3 F: ACTGC CTCTTCAAGGTGTGC; ITPR3 R: CCCATGCACCTTC TTGTTCT; RYR1 F: GTCATCCTGTTGGCCATCATC; RYR1 R: GGTCTCGGAGCTCACCAAAAG; RYR3 F: GGCCACAGGACCCTGTTAT; RYR3 R: CTGTGGCATG TTCCCGTAG; S100A6 F: GAAGGAGCTGAAGGAGCT GA S100A6 R: CCCTTGAGGGCTTCATTGTA 18S F: CG GCTACCACATCCAAGGAA; 18S R: GCTGGAATTAC CGCGGCT; ARF1 F: GACCACGATCCTCTACAAGC; ARF1 R: TCCCACACAGTGAAGCTGATG.

Total RNA was extracted using TRIZOL (Invitrogen) in accordance with the manufacturer’s protocol. Extracted RNA (2 μg) was reverse transcribed with random hexamer primers (Boehringer-Mannheim) using the Superscript II kit (Invitrogen). Relative gene expression was quantified using the 2^△△C_T method on a LightCycler 480 real-time PCR System (Roche Applied Science, Indianapolis, IN, USA) together with the Universal Probe Library (Roche Applied Science).

To isolate RNA, the DNA in total nucleic acid extracts of infected keratinocytes was degraded using a Turbo DNA-free Kit (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA was reverse transcribed using SuperScript II kit (Invitrogen, Life Technologies, Carlsbad, CA, USA). Quantitative real time PCR was performed as described above using 1 μM forward and reverse primers (Table 1), designed using Primer 3 software (bioinfo.ut.ee/primer3-0.4.0/) and 12.5 ng of cDNA template in a total volume of 10 µL. PCR conditions were as follows: 5 min at 95 °C, 40 amplification cycles comprising 20 s at 95 °C, 15 s at 64 °C and 20 s at 72 °C. Samples were normalized with regard to two independent control housekeeping genes (Glyceraldehyde-Phospho-Dehydrogenase and 28S rRNA gene) and reported according to the ΔΔCT method as RNA fold increase: 2^ΔΔCT = 2^{ΔCT sample − ΔCT reference}.