RNAiso Plus (Invitrogen) was used to extract total RNA according to the manufacturer’s protocol. Complementary DNAs (cDNAs) were synthesized from RNA samples (1 μg) by RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). qRT-PCR was performed via a SYBR Green Mix kit (Bio Rad Laboratories, Hercules, CA). Analysis of the relative expression was based on the 2−ΔΔCt method. The primers were as follows: GAPDH-forward: 5'-GGTGAAGGTCGGTGTGAACG-3' and GAPDH-reverse: 5'-CTCGCTCCTGGAAGATGGTG-3'; MBD3-forward: 5'-CGGCCACAGGGATGTCTTTT-3' and MBD3-reverse: 5'-TGCTGGGGTGGTTGGTAATC-3'; MMP2-forward: 5'-CACAGGAGG AGAAGGCTGTG-3' and MMP2-reverse: 5'-GAGCTTGGGAAAGCCAGGAT-3'; MMP9-forward: 5'-TTCAGGGAGACGCCCATTTC-3' and MMP9-reverse: 5'-TGTAGAGTCTCTCGCTGGGG-3'.
Sybr green mix kit
Manufactured by Bio-Rad
Sourced in United States
The SYBR Green Mix kit is a reagent designed for real-time PCR applications. It contains a proprietary SYBR Green I dye, which binds to double-stranded DNA and emits a fluorescent signal upon excitation. The kit provides the necessary components to perform quantitative analysis of DNA samples in a real-time PCR instrument.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Rnaiso plus, by Thermo Fisher Scientific (2 mentions)
Primescript reverse transcriptase, by Takara Bio (1 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (1 mentions)
Rt kit, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Cfx connect system, by Bio-Rad (1 mentions)
Cxf manager software, by Bio-Rad (1 mentions)
Rna purification kit, by Takara Bio (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
6 protocols using sybr green mix kit
1
RNA Extraction and qRT-PCR Analysis
2
Quantifying Gene Expression in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a RNA Prep Pure Plant Kit (TIANGEN, Beijing) and cDNA was synthesized with Oligo (dT) 18 or a random primer, and reverse-transcribed using PrimeScript Reverse Transcriptase (TaKaRa Bio Inc., Dalian). Real-time RT-PCR was performed using a SYBRGreen Mix Kit (Bio-Rad, Hercules, CA) on an ABI 7500 real-time PCR system with three biological replicates. The rice ubiquitin gene LOC_Os03g13170 was used as an endogenous control. Primers for real-time RT-PCR are listed in Supplementary Table S4 . The 2−ΔΔCT method was adopted to analyse relative gene expression (Livak and Schmittgen, 2001 (link)).
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted via RNAiso Plus (Invitrogen, Carlsbad, CA, USA) according to the instructions provided by the manufacturer. A RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) was utilized for the synthesis of complementary DNA from RNA samples (1 μg). A SYBR Green Mix kit (Bio Rad Laboratories) was used to perform quantitative real-time polymerase chain reaction. The relative expression was determined based on the 2-ΔΔCt method. The primers used in this experiment are presented in Table 1 .
4
Quantitative PCR Protocol for mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells was extracted with TRIzol reagents (Invitrogen, USA). The template cDNAs were generated with reverse transcription (RT) kit from Takara (Cat. No. R037A). The qPCR assay was conducted using the Bio-Rad CFX Connect system with the SYBR Green mix kit (Cat. No. B21202, Bimake China). GAPDH was used as a reference gene to normalize mRNA expression levels of samples. The qPCR primers are listed in Table 2 .
5
Quantification of β-actin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from MTE pre-amplified samples was taken and gene expression of β-actin was determined by CFX96 RT-PCR using the SYBR Green mix kit (Bio-Rad laboratories). Both forward (GATGCCCTGAGGCTCTTTTCC) and reverse (TGGCATAGAGGTCTTTACGGATGT) primers (Sigma–Aldrich) that bind to β-actin sequences within the MTE pre-amplified region were used at final concentration of 500 nM for each primer. The quantification cycle (Cq) of β-actin was determined from each sample, in duplicate, after 30 cycles of amplification by Bio-rad CXF manager software (Bio-Rad laboratories). Melting curve was generated in all PCRs to check for presence of non-specific products. Samples with a Cq of more than 14 were exempted from further hybridization procedures.
6
Quantifying lncRNA LSINCT5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted from EOC tissues and human ovarian cancer cell lines using Trizol reagent (Takara Bio, Inc., Otsu, Japan) and purified using an RNA Purification kit (Takara Bio, Inc.). Reverse transcription was performed using PrimeScript RT master Mix (Takara Bio, Inc.). qPCR was performed using a SYBR-Green MIX kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The primer sequences used for human LSINCT5 are as follows: Forward, 5′-CCAGCUACAAACCUCUGAATT-3′, and reverse, 5′-UUCAGAGGUUUGUAGCUGGTT-3′. GAPDH (sequences: Forward, 5′-AGGGCTGCTTTTAACTCTGGT-3′, and reverse, 5′-CCCCACTTGATTTTGGAGGGA-3′) was used as an internal standard, the relative expression of each gene was normalized to GAPDH. PCR cycling conditions were as follows: 95°C for 5 min, followed by 40 cycles of 95°C for 30 sec, 60°C for 20 sec and 72°C for 20 sec. Relative quantification of mRNA was performed using comparative threshold cycle (CT) method. This value was used to plot the gene expression employing the formula 2−ΔΔCq (12 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!