RNA was purified using TriZol (Thermo Fischer) chloroform RNA extraction. A total of 1 µg of DNAse-treated RNA was used for cDNA synthesis with Maxima H Reverse Transcriptase (Thermo Fischer). Relative quantification of gene expression was performed with 5 µL of cDNA mixed with SYBR green polymerase chain reaction mastermix (Qiagen). Primers specific for ZBED1 (Qiagen, QT00224140), PUM1 (Qiagen, QT00029421), 5′-LTR (5′-TGGCTAACTAGGGAACCCACTGCT, 3′-TCACACAACAGACGG GCACACAC), GCM1 (5′-TGGGACTTGAACCAGCAGTAAG, 3′-CAGGAGATTGTT TTCTAGGGCTTCT), hCG-β subunit 3 (hCGβ) (5′-CTACTGCCCCACCATGACCC, 3′-GATGGACTCGAAGCGCACAT), dysferlin (5′-TATGCCGA GAACGTCCACAC, 3′-TCTTCACCCCTGCAAACACC), and syncytin-1 (5′-TCCGTACCCATACTCGCCTG, 3′-AGTAGGGTTTTGGGCCGAGA) were used. The qPCR data were analyzed using the comparative CT method in the StepOne software (version). Mean CT values were normalized to PUM1 and (2-(CT_primer/CT_PUM1)).
Maxima h reverse transcriptase
Manufactured by Thermo Fisher Scientific
Maxima H Reverse Transcriptase is a recombinant reverse transcriptase enzyme designed for efficient cDNA synthesis from RNA templates. It possesses RNA- and DNA-dependent DNA polymerase activity and RNase H activity.
Automatically generated - may contain errors
Lab products found in correlation
Rnaclean xp, by Beckman Coulter (3 mentions)
Nextera dna index sequences, by Illumina (2 mentions)
Nano kit v2, by Illumina (2 mentions)
Ampure xp, by Beckman Coulter (2 mentions)
Taqman fam mgb, by Bio-Rad (2 mentions)
Taqman universal master mix, by Thermo Fisher Scientific (2 mentions)
Cfx96, by Bio-Rad (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (2 mentions)
Dna prep kit, by Illumina (1 mentions)
Novaseq platform, by Illumina (1 mentions)
Tcl buffer, by Qiagen (1 mentions)
β mercaptoethanol, by Merck Group (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Dojindo Laboratories (1 mentions)
Rnase inhibitor, by Takara Bio (1 mentions)
100 and 40 μm cell strainers, by Corning (1 mentions)
Protease inhibitor cocktail, by Roche (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
Facsaria 2, by BD (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
10 protocols using maxima h reverse transcriptase
1
Quantitative Gene Expression Analysis by qPCR
2
Single-cell antibody repertoire profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single-cell RNA was purified using magnetic beads (RNAclean XP, Beckman Coulter). RNA was reverse transcribed to cDNA using oligodT primers and Maxima H- reverse transcriptase (Thermo Fisher Scientific). Heavy chains and lambda light chains were amplified separately using consensus VH and VL forward primers and reverse constant primers80 (link),81 (link). Well-specific 9-nucleotide barcodes were introduced via PCR to the 5’ end. Plate-specific indexing was introduced via PCR by adapting Illumina Nextera DNA index sequences. PCR products from individual plates were pooled and purified using magnetic beads (Ampure XP, Beckman Coulter). Plates were pooled at equal concentrations and sequenced with a 500-cycle reagent Nano kit v2 (Illumina) on the Illumina Miseq platform. Oligo sequences are provided in Table S2 .
3
Quantitative Real-Time PCR Protocol for RiboTag Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RiboTag IP samples, an equal fraction of captured RNA was reverse transcribed (1.5 μL of the 14 μL elution from RNEasy MinElute purification). For Input or other tissue samples, 20–50 ng of total RNA was reverse transcribed. RNA was reverse transcribed in a 20-μL reaction with 0.5 U of Maxima H Reverse Transcriptase (ThermoFisher, catalog # EP0753) and random hexamers (5 μm, ThermoFisher catalog #SO142).
A quantitative PCR was run with TaqMan Universal Master Mix (ThermoFisher catalog #4440042) and TaqMan FAM-MGB primer/ probe sets spanning exon junctions on a BioRad CFX96. The following primer/probe sets were used (ThermoFisher): Mouse ActB, Μm01205647_g1; Mouse Th, Μm00447557_m1; Mouse Slc6a3/DAT, Μm00438388_m1; Mouse Slc18a2/VMAT2, Μm00553058_m1; Mouse Gfap, Μm01253033_m1; Mouse Mbp, Μm01266402_m1; and ERCC-0096, Ac03460023_a1. For RiboTag IP samples, an equal fraction of cDNA was used in each reaction. For Input or other tissue samples, 3–5 ng cDNA was used in each reaction.
A quantitative PCR was run with TaqMan Universal Master Mix (ThermoFisher catalog #4440042) and TaqMan FAM-MGB primer/ probe sets spanning exon junctions on a BioRad CFX96. The following primer/probe sets were used (ThermoFisher): Mouse ActB, Μm01205647_g1; Mouse Th, Μm00447557_m1; Mouse Slc6a3/DAT, Μm00438388_m1; Mouse Slc18a2/VMAT2, Μm00553058_m1; Mouse Gfap, Μm01253033_m1; Mouse Mbp, Μm01266402_m1; and ERCC-0096, Ac03460023_a1. For RiboTag IP samples, an equal fraction of cDNA was used in each reaction. For Input or other tissue samples, 3–5 ng cDNA was used in each reaction.
4
Single-Cell RNA Sequencing of B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single GC B cells and PCs from two independent experiments were sorted into 96-well plates containing 5 μl TCL buffer (Qiagen), supplemented with 1% β-mercaptoethanol (Sigma-Aldrich) using a BD FACS Symphony S6 sorter. Single-cell RNA was purified using magnetic beads (RNAclean XP, Beckman Coulter). RNA was reverse transcribed to cDNA using oligodT primers and Maxima H− reverse transcriptase (Thermo Fisher Scientific) to generate “template-switched” cDNA and amplified as previously described (Islam et al., 2014 (link); Picelli et al., 2014 (link); Trombetta et al., 2014 (link)). Libraries were prepared using an Illumina DNA Prep kit (Illumina), indexed using IDT for Illumina Index Sets (Illumina), and sequenced on an Illumina NovaSeq platform (Rockefeller University Genomics Resource Center).
5
Single-cell antibody repertoire profiling
6
Quantitative Real-Time PCR Protocol for RiboTag Analysis
7
Quantitative Retinal Gene Expression
8
Isolation and Profiling of Pdgfra+ Nuclei from Bile Duct Ligated Mouse Livers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh frozen livers of PdgfraEGFP mice subjected to BDL or sham operation were sectioned into 100-μm-thick sections using cryostat on day 21 post-operation. The sections (20 mg) were collected into homogenisation tubes (BMS, Tokyo, Japan) containing 3 mm zirconia beads (BMS). The samples were homogenised in 1 mL of hypotonic buffer comprising 250 mM sucrose, 10 mM KCl, 5 mM MgCl2, 10 mM Tris-HCl (pH 8.0), 25 mM HEPES, 0.1 mM dithiothreitol, 0.1% Triton X-100, 0.2 U/μL RNase inhibitor (Takara, Shiga, Japan), and protease inhibitor cocktail (Roche, Basel, Schweiz) for 10 s using a Shakeman homogeniser (BMS). The samples were incubated on ice for 15 min and homogenised again for 10 s using the homogeniser. The lysate was filtered through 100- and 40-μm cell strainers (CORNING), followed by filtration through a 5-mL filter cap FACS tube (CORNING). DAPI (1:5000; DOJINDO) was used to stain the DNA. From each population, 10,000 nuclei were collected using FACSAriaII (BD Biosciences, San Jose, CA, USA). Total RNA was extracted from the samples using the RNeasy Micro kit (Qiagen, Hilden, Germany). The cDNA was synthesised from the extracted RNA using Maxima H reverse transcriptase (Thermo Fisher Scientific).
9
Amplification and Cloning of gstD-GFP Reporter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We amplified the gstD-GFP reporter from transgenic fly genomic DNA for InFusion cloning into BglII/NotI-digested pattB using the following oligos: gstD-GFP-F: attcgttaacagatcattgcaactggttgttaacct gstD-GFP-R: cctcgagccgcggcccgccttaagatacattgatgagt. For qRT-PCRs, we reverse transcribed approximately 500 ng of total RNA from S2 cells in a 20 µL reaction with random primers using Maxima H reverse transcriptase (Thermo Scientific, cat. #EP0752) following manufacturer protocols. From this, we used 1 µL of cDNA per well for qPCR on a BioRad CFX96 Touch Real-Time PCR Detection System (BioRad, cat. #1855196) using Power SYBR Green PCR master mix (Life Technologies, cat. #4367659). We determined cycle threshold (Ct) values with BioRad CFX Manager software. For mRNA fold change calculations, we used the ∆∆Ct method, normalized to the housekeeping gene RpL15 (Livak and Schmittgen, 2001 (link)). We used the following oligos for qRT-PCR:
10
Full-length cDNA Synthesis and Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full length cDNA synthesis from RNA was carried out using Maxima H-reverse transcriptase (ThermoFisher, K1651) following the manufacturer's directions with 2 μg of total RNA and 100 pmol of d(T)20 VN primer. The cDNA synthesis reaction was carried out at 50 °C for 30 min, 55 °C for 10 min, 60 °C for 10 min, 65 °C for 10 min, and 85 °C for 5 min. Full length Runx2, Mmp13, Cxcl14, and Gas1 were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) and cloned using CloneJET PCR Cloning Kit (ThermoFisher, K1231). Following confirmation of cloning of full length coding sequences by Sanger sequencing, Runx2, Mmp13, Cxcl14, and Gas1 were cloned into pEPIC1.1 digested with AflII (NEB, R0520S) and EcoRI (NEB, R3101S) or pPIDNB digested with AflII (NEB, R0520S) and PstI (NEB, R3140S) using NEBuilder HiFi DNA Assembly Master Mix. All constructs were verified by Sanger sequencing and midipreped for electroporation and transfection using PureLink Fast Low-Endotoxin Midi Kit (Invitrogen, A36227).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!