Mouse skeletal muscle-derived C2C12 myoblasts (GNM26) were purchased from the Chinese Academy of Sciences (Shanghai, China). Fetal bovine serum (FBS) was purchased from Clark Bioscience (Richmond, VA, USA). Horse serum was purchased from GIBCO (Life Technologies, Carlsbad, CA, USA). DEX was purchased from Sigma (St. Louis, MO, USA). The lactic dehydrogenase (LDH) Biochemical Analysis Kit was purchased from Jiancheng Bioengineering Institute (Nanjing, China). Fluo-3/AM and the BCA Protein Assay Kit were purchased from Beyotime Biotechnology (Shanghai, China). Protease/phosphatase inhibitor cocktails were purchased from Roche (Basel, Switzerland). Primary antibodies against myogenin, MuRF 1, atrogin-1, phosphorylated AMPK (p-AMPK), AMPK, phosphorylated PI3K (p-PI3K), PI3K, phosphorylated Akt (p-Akt), Akt, GLUT4, and GAPDH were obtained from Cell Signaling Technology (Beverly, MA, USA). p-AS160 was obtained from OmnimABs (Alhambra, CA, USA). Chemiluminescence reagents were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
Murf1
Manufactured by Cell Signaling Technology
Sourced in United States
MuRF1 is a protein that plays a role in the regulation of muscle protein degradation. It functions as an E3 ubiquitin-protein ligase, which is involved in the ubiquitination and subsequent proteasomal degradation of target proteins.
Automatically generated - may contain errors
Lab products found in correlation
Atrogin 1, by Cell Signaling Technology (2 mentions)
Foxo3a, by Cell Signaling Technology (2 mentions)
P p70s6k, by Cell Signaling Technology (2 mentions)
P akt, by Cell Signaling Technology (2 mentions)
P mtor, by Cell Signaling Technology (2 mentions)
P70s6k, by Cell Signaling Technology (2 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Chemiluminescence reagent, by Santa Cruz Biotechnology (1 mentions)
Myogenin, by Cell Signaling Technology (1 mentions)
Horse serum, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Clark Bioscience (1 mentions)
Protease phosphatase inhibitor cocktail, by Roche (1 mentions)
Glut4, by Cell Signaling Technology (1 mentions)
Gapdh, by Cell Signaling Technology (1 mentions)
Dexamethasone (dex), by Merck Group (1 mentions)
Bca protein assay kit, by Beyotime (1 mentions)
Fluo 3 am, by Beyotime (1 mentions)
Block it pol 2 mir rnai expression vector kit, by Thermo Fisher Scientific (1 mentions)
Pcdna6.2 gw emgfp mir vector, by GenePharma (1 mentions)
Mafbx, by Cell Signaling Technology (1 mentions)
6 protocols using murf1
1
Myoblast Differentiation and Metabolic Regulation
2
Validating miR-628 Regulation of IRS1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mature rat miR-628 (AUGCUGACAUAUUUACGAGAGG) was cloned into a pcDNA6.2-GW/EmGFP-miR vector (GenePharma Co., Ltd., Shanghai, China) using a BLOCK-iT Pol II miR RNAi Expression Vector Kit (Life Technologies, Grand Island, NY, USA). The rat IRS1 mRNA 3'-UTR sequence (1069 base pairs) was cloned into a pGL3 luciferase assay vector (IRS1 3'-UTR luciferase reporter). Antibodies against IRS1, Akt, p-Akt S473, FoxO3a, p-FoxO3a S253, MuRF-1, MAFbx and cleaved caspase 3 were purchased from Cell Signaling Technologies (Beverly, MA, USA). β-Actin antibodies were purchased from Sigma-Aldrich (St Louis, MO, USA). The pan-caspase inhibitor Z-VAD-FMK was purchased from Abcam (Cambridge, MA, USA).
3
C2C12 Myotube Protein Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The C2C12 myotubes were lysed with RIPA buffer (Biosharp, Hefei, China) containing protease inhibitor (Roche, Basel, Switzerland) and phenylmethylsulfonyl fluoride to extract total proteins. The protein was extracted via centrifugation at 12,000× g for 15 min at 4 °C, and the protein concentration was determined with a BCA protein assay kit (Thermo Scientific, Waltham, MA, USA). An equal amount of protein (120 µg) was separated by 10–12% SDS-PAGE gel and transferred to the PVDF membranes at different electric currents depending on the size of the protein molecule. The membranes were blocked with 5% non-fat milk and incubated with primary antibodies. Protein expression was detected using a primary antibody. p-Akt (Ser473), p-S6K (Thr389), p-IRS-1 (Thr307), IRS-1, and MuRF1 were from Cell Signaling (Beverly, MA, USA). Akt, S6K, Atrogin-1, and GADPH antibodies were from Proteintech Antibody. PGC-1α and secondary antibodies were from Abcam (Cambridge, MA, USA).
4
Measuring Muscle Protein Degradation Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As a protein degradation factor, myostatin further induces the Smad2/3 signaling mediator, which results in higher expression of MuRF1 [25 (link)]. Muscle protein degradation markers were analyzed by Western blot methods. The method of muscle sample preparation was the same as that for the measurement of muscle protein synthesis. The primary antibodies were the rabbit polyclonal myostatin (Protein Tech, Manchester, UK), rabbit monoclonal Smad2/3 (Cell Signaling Technology), and rabbit polyclonal MuRF1 (Cell Signaling Technology). An anti-rabbit IgG antibody (1:5000; C04003, Croyez Bioscience, Taipei, Taiwan) was used as the secondary antibody in this study.
5
Protein Expression Analysis in Skeletal Muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein was extracted from skeletal muscle by the protein extraction Kit (KeyGEN). Protein concentration was determined with BCA Protein Assay Kit (Takara), and an equal amount of protein was separated on SDS-polyacrylamide gel electrophoresis. After transferring to a polyvinylidene fluoride (PVDF) membrane (Millipore), the primary antibody and the corresponding secondary antibody were used to detect protein of interest. The antibody used in this study were as follows: Atrogin-1 (Abclonal); MuRF-1 (Abclonal); LC3 (Abclonal); P62 (Abclonal); Ndufb2 (Abclonal); Clusterin (Abclonal); IGF1 (Abclonal); PI3K(p85α) (Abclonal); P-mTOR (Abclonal); mTOR (Abclonal); P-P70S6K (Abclonal); P70S6K (Abclonal); P-FOXO3A (Abclonal); FOXO3A (Abclonal); P-EIF4EBP1 (Abclonal); EIF4EBP1 (Abclonal); P-AKT (Cell Signaling Technology); AKT (Proteintech); and GAPDH (Bioworld Technology). The protein was visualized using High-sig ECL Western Blotting Substrate (Tanon) and imaged using the Tanon-5200S Chemiluminescent Imaging System (Tanon).
6
Muscle Protein Signaling Pathway Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The soleus fibers were homogenized using a lysis buffer and centrifuged at 13,000 rpm for 20 minutes. Protein concentration was measured via colorimetric protein assay kit (Bio-Rad, Hercules, CA, USA). Proteins (30 µg) were separated on sodium dodecyl sulfate-polyacrylamide gels and transferred onto a nitrocellulose membrane on ice. The membranes were incubated using 5% skim milk with Tris-buffered saline which is containing 0.1% Tween-20 (TBS-T) and then, incubated overnight at 4°C with the following primary antibodies: GAPDH, Bcl-2, Bax, cytochrome c (Santa Cruz Biotechnology, Santa Cruz, CA, USA), Akt, p-AKT, mTOR, p-mTOR, p70S6k, p-p70S6k, 4EBP1, p-4E-BP1, FOXO3, MuRF1, and Atrogin-1 (Cell Signaling Technology, Danvers, MS, USA). The membranes were incubated for 1 hour with secondary antibodies: horseradish peroxidase (HRP)-conjugated anti-mouse (Santa Cruz Biotechnology) or goat anti-rabbit IgG-heavy and light chain antibody HRP conjugated. After washing 3 times in TBS-T, an enhanced chemiluminescence detection kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to detect the band. Protein bands was expressed using a ChemiDoc (Bio-Rad). All protein levels were calculated with GAPDH as a ratio.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!