Matrigel coated well

Aniridia patient iPSCs were generated using non-integrating episomal reprogramming of dermal fibroblasts extracted from a skin biopsy from the patient’s arm, following established protocols.²⁸ (link)^,53 (link) A minimum of 2 clonal lines were expanded and characterized as described previously.²⁹ (link)^,53 (link) The control (WT) iPSCs used in this study have been published previously.⁵³ (link) The H9 ESC line was obtained from WiCell (hPSCreg WAe009-A). All iPSC lines were maintained in mTESR Plus medium (STEMCELL Technologies, Canada) with 0.1% penicillin/streptomycin (Pen/Strep) on Matrigel-coated wells (1:100) (Corning, USA). For passaging, ReLESR (STEMCELL Technologies) was used for detaching, and after 24 h, iPSCs were fed daily with mTESR Plus until confluent.

Transfected cells were added to the upper chambers of Matrigel coated wells (Corning, NY, USA) for invasion and migration assays, respectively. Cells in the upper chambers were cultured in media with 10% fetal bovine serum, whilst cells in the lower chambers were assessed for migration or invasion. After 24 h, noninvasive or non-migrating cells were carefully removed using a swab, and invaded or migrated cells were fixed with formaldehyde and stained with crystal violet. These cells were imaged and enumerated via light microscopy.

Human iPSC lines HuAiPSC‐A1¹⁹ and HuAiPSC‐A1‐RHD^−/− were cultured in Essential 8 (Gibco, Grand Island, NY) on Matrigel‐coated wells (Corning, New York). Cells were maintained daily and passaged every 4–6 days to maintain undifferentiated growth, as previously described.¹⁹ When colonies reached 70%–80% confluency, ReLeSR (StemCell Technologies, Vancouver, BC, Canada) was used to detach and dissociate large clones, and cells were passaged at a 1:10–1:20 ratio. Single cells were obtained using Accutase (StemCell Technologies) before plasmid transfection and fluorescence‐activated cell sorting (FACS). A rock inhibitor (Y‐27632 2HCl, Selleck, Houston, TX) was used to improve the cell survival rate during replating. All cultures were maintained at 37°C in a 5% CO₂ incubator (Thermo Scientific, Waltham, MA).

We used two hiPSC lines obtained from two donors, previously obtained by integration-free reprogramming of erythroblasts with episomal vectors [14 (link)]. The cells were plated in Matrigel-coated wells (Corning; New York, NY, USA) and cultured with mTeSR1™ (Stem Cell Technologies; Vancouver, Canada). The medium was exchanged daily, and the cells were passaged with ReleSR (Stem Cell Technologies; Vancouver, Canada) when 80% confluence was reached, followed by replating in a 1 : 10 split ratio.

The Personal Genome Project hiPS cell line PGP1 (56 (link)) was a gift from George Church (https://www.encodeproject.org, accession number: ENCBS368AAA). The cells were cultured on Matrigel-coated wells (Corning, 354277) in mTeSR1 medium (STEMCELL Technologies, 85850) and passaged in the presence of ROCK Inhibitor InSolution Y-27632 (MilliporeSigma, 688001). The 4D-Nucleofector System (Lonza) was used to electroporate piggyBac and transposase vectors into PGP1 cells in suspension (X-Unit, P3 Primary Cell 4D-Nucleofector X Kit L, program CB-156) following the manufacturer’s protocol. After nucleofections, cells were selected with 20 μg/mL Bla (Thermo Fisher Scientific, A1113903) for 5 days. The selected cells were seeded at low densities and propagated until each single cell formed a colony. Colonies were selected and genotyped using primers specifically binding to rod and cone reporter cassettes. The monoclonal cell line carrying both reporter cassettes (PGP1dR) at passage numbers 33–38 was used for all further experiments. The primer sequences were as follows: hRHO forward, GGATACGGGGAAAAGGCCTCCACGGCCACTAGTAGTTAATGATTAACCCG; hRHO reverse, GACGTCCTCGGAGGAGGCCATGGTGGCTGCAGAATTCAGGGGATGACTCT; mCAR forward, CTGGGGGGATACGGGGAAAAGGCCTCCACGGCCACTAGTGGTTCTTCCCATTTTGGCTAC; mCAR reverse, GAACAGCTCCTCGCCCTTGCTCACCATGGTGGCTCTAGACCTCCAGCTCTGGTTGCTAAGCTGGC.