Log In Sign up
The largest database of trusted experimental protocols

Iqsybr green supermix

Manufactured by Quanta Biosciences
Visit Supplier
Sourced in United States

The IQSYBR Green Supermix is a ready-to-use solution for real-time PCR amplification and detection. It contains all the necessary components, including a DNA polymerase, SYBR Green I dye, and optimized buffer system, to perform quantitative PCR analyses.

Automatically generated - may contain errors

Lab products found in correlation

Cfx connect instrument, by Bio-Rad (3 mentions) Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Iscript cdna synthesis kit, by Quanta Biosciences (1 mentions)

3 protocols using iqsybr green supermix

1

Reverse Transcription and RT-qPCR Analysis of HuR Target mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from IP material was subjected to reverse transcription using random hexamers and SuperScriptII reverse transcriptase (Invitrogen). The mRNA levels of HuR target were measured by RT–qPCR analysis using iQSYBR Green Supermix (Quanta BioSciences, Inc., Gaithersburg, MD, USA) and a Bio-Rad CFXConnect instrument (Bio-Rad, Hercules, CA, USA). Background binding of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used as a loading control. Each reaction was carried out in triplicate, and three independent experiments were performed. The primer sequences used were: BCL6, 5'-AACCTGAAAACCCACACTCG-3' and 5'-TTCGCATTTGTAGGGCTTCT-3' Blk, 5'-TGTGGTCACCAGAGAGCCCATTTA-3' and 5'-TGTCAATCAGCCTTGGAAGGGACA-3' ALDH1A1, 5'-ACAAGGTGGCCTTCACTGGA-3' and 5'-GCAAACACAATGCAAGGGCT-3'; ALDH1A2, 5'-TGGGTGAGTTTGGCTTACGG-3' and 5'-AGAAACGTGGCAGTCTTGGC-3'; NS3, 5'-CCACATAGACGCCCATTTCT-3' and 5'-GCTCCCAGCCTATACAGCAG-3'; Btk, 5'-TGCAAGGATGTCTGTGAAGC-3' and 5'-GGACAGGCCGAAATCAGATA-3' CARD11, 5'-TGAATGTAATGCTGGGGACA-3' and 5'-GGCAAGCTGTTCACAAACAA-3'; GAPDH, 5'-CGGAGTCAACGGATTTGGTCGTA-3' and 5'-AGCCTTCTCCATGGTGGTGAAGAC-3'.
Dai B., Chen A.Y., Corkum C.P., Peroutka R.J., Landon A., Houng S., Muniandy P.A., Zhang Y., Lehrmann E., Mazan-Mamczarz K., Steinhardt J., Shlyak M., Chen Q.C., Becker K.G., Livak F., Michalak T.I., Talwani R, & Gartenhaus R.B. (2015). Hepatitis C virus upregulates B-cell receptor signaling: a novel mechanism for HCV-associated B-cell lymphoproliferative disorders. Oncogene, 35(23), 2979-2990.
+ Open protocol
+ Expand
2

Quantifying Gene Expression via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total and polysomal RNA were reverse transcribed with the iScript cDNA synthesis kit (Quanta Biosciences), and qPCR analysis was carried out using iQ SYBR Green Supermix (Quanta Biosciences) on a BioRad CFXConnect instrument. Oligonucleotides used for detection of specific mRNAs in each fraction from sucrose gradients are as follows: CTGGCTAAAGCTGGTGAAGG and TGGGTCTATTGGCCTTTCTG for FKBP11 mRNA, CCGCTGGTTTAACATTTCGT and TCAGCAACTGCTGGAAAATG for MARS mRNA, CATGGACTCCAGGAGGGTAA and TCACAGGTGACTGGGGTGTA for CDC25A mRNA, TATGACCCCCACCCAGATAG and ACTAAGCGCCAGAAACTGGA for TCL1A mRNA, GGAGGAGCCCATTTACATCA and ATGTATGCCATTCCCTCTGC for LYN mRNA, AGACGGAAGGTGCTGAGAAA and GAAGCATTGGGGATCAAGAA for YWHAZ mRNA and, CGGAGTCAACGGATTTGGTCGTAT and AGCCTTCTCCATGGTGGTGAAGAC for GAPDH mRNA.
Mazan-Mamczarz K., Peroutka R.J., Steinhardt J.J., Gidoni M., Zhang Y., Lehrmann E., Landon A.L., Dai B., Houng S., Muniandy P.A., Efroni S., Becker K.G, & Gartenhaus R.B. (2015). Distinct inhibitory effects on mTOR signaling by ethanol and INK128 in diffuse large B-cell lymphoma. Cell Communication and Signaling : CCS, 13, 15.
+ Open protocol
+ Expand
3

Quantification of HuR Target mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from IP material was subjected to reverse transcription using random hexamers and SuperScriptII reverse transcriptase (Invitrogen). The mRNA levels of HuR target were measured by RT-qPCR analysis using iQSYBR Green Supermix (Quanta BioSciences, Inc., Gaithersburg, MD, USA) and a Bio-Rad CFXConnect instrument (Bio-Rad, Hercules, CA, USA). Background binding of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used as a loading control. Each reaction was carried out in triplicate, and 3 independent experiments were performed. The primer sequences used were: BCL6, AACCTGAAAACCCACACTCG and TTCGCATTTGTAGGGCTTCT; Blk, TGTGGTCACCAGAGAGCCCATTTA and TGTCAATCAGCCTTGGAAGGGACA; ALDH1A1, ACAAGGTGGCCTTCACTGGA and GCAAACACAATGCAAGGGCT; ALDH1A2, TGGGTGAGTTTGGCTTACGG and AGAAACGTGGCAGTCTTGGC; NS3, CCACATAGACGCCCATTTCT and GCTCCCAGCCTATACAGCAG; BTK, TGCAAGGATGTCTGTGAAGC and GGACAGGCCGAAATCAGATA; CARD11, TGAATGTAATGCTGGGGACA and GGCAAGCTGTTCACAAACAA; GAPDH, CGGAGTCAACGGATTTGGTCGTA and AGCCTTCTCCATGGTGGTGAAGAC.
Dai B., Chen A.Y., Corkum C.P., Peroutka R.J., Landon A., Houng S., Muniandy P.A., Zhang Y., Lehrmann E., Mazan-Mamczarz K., Steinhardt J., Shlyak M., Chen Q.C., Becker K.G., Livak F., Michalak T.I., Talwani R, & Gartenhaus R.B. (2015). Hepatitis C virus upregulates B-cell receptor signaling: a novel mechanism for HCV-associated B-cell lymphoproliferative disorders. Oncogene, 35(23), 2979-2990.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!