Pcrbio taq mix red
PCRBIO Taq Mix Red is a pre-mixed, ready-to-use solution containing Taq DNA Polymerase, buffer, and dNTPs for standard PCR amplification. It is designed for reliable and consistent PCR performance.
Lab products found in correlation
9 protocols using pcrbio taq mix red
DNA Barcoding Across Diverse Plant Species
Fungal Genomic DNA Extraction and Amplification
Chloroplast and Nuclear DNA Extraction and Sequencing
Genome Editing Protocol: CRISPR-Cas9 and T-DNA Integration
To detect T-DNA integration in the case of stable transformation, or plasmid integration in the case of transient plasmid delivery, a PCR was performed using genomic DNA as template (100 ng) and the primer pair Cas9wt for (CTTCAGAAAGGACTTCCAATTC) and Cas9wt rev (ATGATCAAGTCCTTCTTCACTT), using PCRBIO Taq Mix Red (PcrBiosystems) according to manufacturer’s instructions. A single specific amplicon of 693 bp was obtained in the case of positive signal.
DNA Extraction and Molecular Marker Amplification
Genotyping of TNF-α -308G/A Polymorphism
PCR products were separated in 2% agarose gel, stained with ethidium bromide (0.5 μg/mL) and documented under UV illumination using MiniBIS Pro device (DNR Bio-Imaging Systems Ltd., Neve Yamin, Israel).
The 107 bp PCR product was digested with NcoI (New England Biolabs, London, UK) restriction enzyme for 15 min at 37 °C. Three types of bands were observed—a complete NcoI cut representing homozygous TNF-α (-308G/G), resulting in two fragments of 87 and 20 bp; a partial cut representing heterozygous TNF-α (-308G/A), resulting in three fragments of 107, 87 and 20 bp; and an uncut 107 bp fragment representing homozygous TNF-α (-308A/A).
Touchdown PCR for Genetic Amplification
Targeted Genomic Variant Detection in Embryos
Fungal ITS1 Amplification Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!