0.2 × 106 cells/ml TEX cells were plated in 12-well plate in duplicates and treated with RB-3 and/or RB-nc for 6 and/or 10 days followed by RNA isolation according to the manufacturer’s protocol (RNeasy kit Qiagen). For PTC-209, 0.2×106 cells/ml TEX cells were plated in 12-well plate in duplicates and treated with different doses of PTC-209 for 4 days followed by RNA isolation according to the manufacturer’s protocol (RNeasy kit Qiagen). 250ng to 1μg of total RNA was then reverse transcribed to cDNA using HICAP RT kit (Applied Biosystems). Following cDNA synthesis, quantitative PCR was performed using SYBR Green Supermix with ROX (BioRad) using the primers for CEBPA, CD34, CD86, ITGAM, CD48, MS4A3, TIMP3, GAPDH, RNASE2 and CCNA1 (see Supplementary Info for primer sequences). Gene expression analysis was carried out using the 2-ΔΔCT relative quantification method. Duplicate reactions were performed for each tested sample, and the average CT was calculated for the quantification analysis. GAPDH was used as an endogenous reference control. Primary AML samples treated with RB-3 and RB-nc for 12 days were processed in similar manner to isolate RNA, perform cDNA synthesis and quantitative analysis of CEBPA, CD34, ITGAM and CD86.
Sybr green supermix with rox
Manufactured by Bio-Rad
Sourced in United States
SYBR Green Supermix with ROX is a ready-to-use solution for real-time PCR, containing SYBR Green I dye and ROX passive reference dye. It is designed for the detection and quantification of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Hicap rt kit, by Thermo Fisher Scientific (4 mentions)
Rneasy kit, by Qiagen (2 mentions)
Rna isolation kit, by Qiagen (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Iscript reverse transcription kit, by Bio-Rad (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Rna cleanup columns, by Zymo Research (2 mentions)
Rna isolation kit, by Zymo Research (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Abi prism 7500, by Thermo Fisher Scientific (1 mentions)
3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
11 protocols using sybr green supermix with rox
1
Quantification of AML-related Genes
2
Quantification of Gene Expression in NUP98-NSD1 Leukemia Cells
3
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from harvested cells using the RNeasy Mini Kit (Qiagen). RNA samples were then reversed transcribed with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) per the manufacturer’s instructions. Subsequent samples were then diluted to 50 ng/ μL and used as a template for quantitative PCR (qPCR). qPCR was accomplished with a Step One Plus Real-time PCR system (Applied Biosystems) and SYBR® Green Supermix with ROX (BioRad) according to the manufacturer’s protocol. Relative mRNA levels were quantified for ahnak2, akr1c1, ccdc80, hspa1a, hsph1, prss35, rgs2, and rrad using gene-specific primers (S1 Table ).
4
Gene Expression Analysis of Microvessels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from ex vivo isolated microvessel fragments or cultured BCECs using RNA isolation kits from Zymo Research, using manufacturer’s protocol. Total RNA was treated with DNase I (Invitrogen) for 30 min at 37 °C and was purified over RNA cleanup columns (Zymo Research). cDNAs were prepared from cleaned up RNA samples using the iScript reverse transcription kit (Bio-Rad Laboratories) following the manufacturer’s instructions. cDNA samples were diluted fivefold in Rnase-free water and those diluted samples were used for gene expression analysis by qPCR using SYBR Green SuperMix with ROX (Bio-Rad Laboratories). For all the analyses, Gapdh was used as a housekeeping gene control. The primer sequences used in this study are provided in Supplementary Table 5 .
5
Quantitative PCR analysis of scy and rnpB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The scyB gene was amplified by qPCR using the specific primers and protocol described by Soule et al. (2009 b) [32 (link)]. The rnpB gene, as a housekeeping gene, was used for amplification, since its transcription is not affected by UV light [40 (link)]. qRT-PCR reactions were performed using 1.0 ng of cDNA as template, and primers at 200 nM, in a final volume of 20 µL of SYBR Green Supermix with Rox (Bio Rad Laboratories, Inc, Redmond, WA, USA). Each amplicon was about 200 bp in length. The annealing temperature for scyB and rnpB genes was 55 °C and 53 °C, respectively. The concentration of primers for scyB and rnpB genes were 250 nM/50 nM and the 250 nM/100 nM, respectively. The comparative transcripts levels were determined after normalization with rnpB amplicons. The experiments were performed in triplicate.
6
Total RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated from the cultured HeLa cells using the Trizol reagent (Takara, Dalian, China), and 2 μg of RNA were then converted into cDNA with reverse transcriptase M-MLV (Promega), according to the protocol [31 (link)]. After reverse transcription, SYBR Green Supermix with ROX (BioRad, Hercules, CA, USA) was used to perform quantitative RT-PCR. The PCR amplification conditions were set as follows: predenaturation at 94 °C for 3 min followed by denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, elongation at 72 °C for 30 s with repeated 34 cycles and 72 °C for an additional 10 min to repair the termini of the fragments upon the thermal cycle cessation. GAPDH was amplified using the forward primer 5′-GGGAAACTGTGGCGTGAT-3′ and reverse primer 5′-GAGTGGGTGTCGCTGTTGA-3′. FNBP1 was amplified using the forward primer 5′-CTCTGGGATCAGTTTGACAACTT-3′ and reverse primer 5′-TGCCCTGCGTAATCATTCATT-3′.
7
Relative Quantification of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed in a 96 well-plate with each well containing 2 µl of cDNA mix, 0.5 µl of forward and reverse primers (0.5 µM final) listed in Table 3 and 25 µl SYBR-Green Supermix with ROX (Bio-Rad) to a final volume of 50 µl. Samples were run in triplicate. Real-time PCR amplification was conducted with the ABI Prism 7500 sequence detector (Applied Biosystems) over 35 cycles and with an annealing temperature of 63°C. Expression of each target gene was based on relative quantification using the comparative critical threshold (Ct) value method. Relative quantification of a specific gene was evaluated in each reaction by normalization to the Ct value obtained for the endogenous control gene, recA[19] (link). Control reactions without cDNA were used as negative controls.
8
Quantification of AML-related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
0.2 × 106 cells/ml TEX cells were plated in 12-well plate in duplicates and treated with RB-3 and/or RB-nc for 6 and/or 10 days followed by RNA isolation according to the manufacturer’s protocol (RNeasy kit Qiagen). For PTC-209, 0.2×106 cells/ml TEX cells were plated in 12-well plate in duplicates and treated with different doses of PTC-209 for 4 days followed by RNA isolation according to the manufacturer’s protocol (RNeasy kit Qiagen). 250ng to 1μg of total RNA was then reverse transcribed to cDNA using HICAP RT kit (Applied Biosystems). Following cDNA synthesis, quantitative PCR was performed using SYBR Green Supermix with ROX (BioRad) using the primers for CEBPA, CD34, CD86, ITGAM, CD48, MS4A3, TIMP3, GAPDH, RNASE2 and CCNA1 (see Supplementary Info for primer sequences). Gene expression analysis was carried out using the 2-ΔΔCT relative quantification method. Duplicate reactions were performed for each tested sample, and the average CT was calculated for the quantification analysis. GAPDH was used as an endogenous reference control. Primary AML samples treated with RB-3 and RB-nc for 12 days were processed in similar manner to isolate RNA, perform cDNA synthesis and quantitative analysis of CEBPA, CD34, ITGAM and CD86.
9
Quantification of Gene Expression in NUP98-NSD1 Leukemia Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1×105 NUP98-NSD1 cells in required medium with 10% FBS and 1% Pen Strep were seeded in 24-well culture plates in 1 ml medium and treated with indicated doses of BT5 for 4 days. Cells were collected, counted and re-plated at initial cell density with fresh medium and compound for another 4 days. On day 8, cells were collected, washed, and RNA was isolated using Qiagen RNA isolation kit as per manufacturer’s instructions. 250 ng to 1 μg of total RNA was then reverse transcribed to cDNA using HICAP RT kit from Applied Biosystems. Following cDNA synthesis, quantitative PCR was performed using Taqman probes for Hoxa9, Hoxa5, Hoxa7 and Meis125 (link). Gene expression analysis was carried out using the 2-ΔΔCT relative quantification method. Duplicate reactions were performed for each tested sample, and the average CT was calculated for the quantification analysis. GAPDH was used as an endogenous reference control. Expression of NUP98-NSD1 was analyzed using pair of primers, including NUP98 forward primer (TACTACGACAGCCACTTTGGG) and NSD1 reverse primer (TCCAAAAGCCACTTGCTTGG). Quantitative PCR was performed using SYBR Green Supermix with ROX (BioRad) and GAPDH and b-actin were used as an endogenous reference control.
10
RNA Isolation and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from whole brain tissue, ex vivo-isolated BCECs or cultured BCECs using RNA isolation kits from Zymo Research, using the manufacturer’s protocol. Total RNA was treated with DNase I (Invitrogen) for 30 min at 37 °C and was purified over RNA cleanup columns (Zymo Research). cDNAs were prepared from cleaned up RNA samples using the iScript reverse transcription kit (Bio-Rad Laboratories) following the manufacturer’s instructions, followed by fivefold dilution of cDNA samples. These samples were used for gene expression analysis by quantitative real-time PCR using SYBR Green SuperMix with ROX (Bio-Rad Laboratories). For all the analyses, GAPDH was used as an internal control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!