After fixation, cells were stored in 70% ethanol at 4 °C overnight for cell permeabilization. Commercially available probe sets against the NEAT1 5’ segment and middle segment (Stellaris FISH probes, NEAT1 5’ segment with Quasar 670 dye, and NEAT1 middle segment with Quasar 570 dye, Biosearch Technologies, Teddington, UK) and wash and hybridization buffers (Biosearch Technologies) were used according to the manufacturer’s instructions. Hybridization was performed at 37 °C for 5 h. Coverslips were mounted with Prolong Diamond (Invitrogen, Waltham, MA, USA). Slides were stored at −20 °C.
Quasar 670 dye
Manufactured by Biosearch Technologies
Sourced in Denmark
The Quasar 670 dye is a fluorescent dye used in various biological and analytical applications. It has an excitation maximum at 646 nm and an emission maximum at 662 nm, making it suitable for detection in the far-red region of the spectrum.
Automatically generated - may contain errors
Lab products found in correlation
Quasar 570 dye, by Biosearch Technologies (3 mentions)
Lsm 880, by Zeiss (2 mentions)
Prolong diamond, by Thermo Fisher Scientific (1 mentions)
Stellaris fish probe, by Biosearch Technologies (1 mentions)
Airyscan detector, by Zeiss (1 mentions)
Tissue plus o c t compound, by Thermo Fisher Scientific (1 mentions)
Vs120 virtual slide microscope, by Olympus (1 mentions)
Plan apochromat 63x 1.40 oil dic m27 objective, by Zeiss (1 mentions)
Prolong gold antifade mountant with dapi, by Thermo Fisher Scientific (1 mentions)
Stellaris rna fish, by Biosearch Technologies (1 mentions)
Vectashield mountant, by Vector Laboratories (1 mentions)
Prolong diamond antifade mountant, by Thermo Fisher Scientific (1 mentions)
Atto 647n, by Merck Group (1 mentions)
Stellaris probe designer, by Biosearch Technologies (1 mentions)
8 protocols using quasar 670 dye
1
NEAT1 lncRNA Localization Protocol
2
RNA FISH Protocol for Frozen Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Harvested pellets were snap frozen in Tissue-Plus O.C.T. Compound (Fisher HealthCare) and stored at −80°C until further processing. Samples were sectioned at 5 µm thickness and slides were stored at −80°C until staining. Probe sets for RNA FISH were conjugated with Quasar 670 dye and were synthesized by LGC Biosearch Technologies to detect signal from a congregation of multiple probes binding to target DNA. GAPDH probe set was pre-designed by the manufacturer. Probe sets are listed in Figure 2—source data 2 . Staining was carried out according to the manufacturer’s protocol for frozen tissues. Slides were mounted with Prolong Gold anti-fade mountant with DAPI (ThermoFisher) and imaged with the Virtual Slide Microscope VS120 (Olympus) at lower magnification. Confocal microscopy (Zeiss LSM 880) was used to capture images at higher magnification with the Plan-Apochromat 63x/1.40 Oil DIC M27 objective. Fluorescence signal from target RNA FISH probes was captured using a 633 nm excitation wavelength coupled with the Airyscan detector (Zeiss) to achieve the best resolution with improved signal-to-noise ratio (Weisshart, 2014 ). Hoechst signal was captured on the PMT detector utilizing a 405 nm excitation wavelength.
3
Stellaris RNA FISH for PVT1 and MALAT1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Stellaris RNA FISH probe sets (human PVT1 with Quasar® 670 Dye and human MALAT1 with Quasar® 570 Dye) were designed and synthesized by Biosearch Technologies. U87 and U251 cells were cultured, attached to cover glass, and subsequently permeabilized using alcohol, following the established protocols of the Stellaris RNA FISH protocol. The resulting samples were subjected to imaging using a Zeiss Imager.M2 fluorescence microscope. During image processing, the acquired Z‐stack images were converted into a maximum‐intensity projection image for analysis and presentation.
4
Single-Molecule Fluorescence In Situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
smFISH was performed as described earlier (47 (link),48 ). Briefly, custom Stellaris probes recognizing exons of gfp (probes spanning exon-exon junctions were not included) labeled with Quasar 670 dye (Biosearch Technologies) were added to fixed L4-staged animals. RNA hybridization was performed with 0.025 μM of probe mix for 48 h at 37°C in 100 μl of hybridization buffer (10% dextran sulphate (w/v), 2× saline-sodium citrate (SSC), 10% formamide (v/v)). Following a wash in wash buffer (2× SSC, 10% formamide, 0.1% Tween-20 (v/v)) samples were stained with DAPI (4′,6-diamidino-2-phenylindole) for 2 h at room temperature and washed 5 more times. Before imaging, samples were stored in GLOX (2× SSC, 0.4% glucose (w/v), 0.01M Tris, pH 8.0) buffer at 4°C for fewer than 3 hours. Samples were mounted in 10 μl of GLOX buffer and enzymes (glucose oxidase, catalase, and 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (trolox)) and coverslips were sealed with a melted mixture of vaseline, lanolin and paraffin.
5
FISH Probes Targeting TP53 and CDK6
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following FISH probes were purchased from LGC Biosearch Technologies (Lystrup, Denmark): TP53 (Stellaris® FISH Probes, Human TP53 with Quasar® 670 Dye) and CDK6 (Stellaris® FISH Probes, Human CDK6 with Quasar® 570 Dye). FISH was performed according to the manufacturer's recommendations (Stellaris® RNA FISH Protocol for Adherent Cells; https://biosearch-cdn.azureedge.net/assetsv6/bti_stellaris_protocol_adherent_cell.pdf ).
6
Multicolor smFISH Probe Design
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
smFISH probe sets consisting of 20 nt long oligonucleotides with two nt spacing complementary to oskar (CG10901; 99 oligos), nanos (CG5637; 63 oligos), cyclin B (CG3510; 48 oligos), or sfgfp (31 oligos) were designed with the Stellaris Probe Designer (LGC Biosearch Technologies). For oskar, nanos, and cyclinB, oligonucleotides with a 3′ amine modification were obtained from Biosearch Technologies, conjugated to Atto 647N or Atto 565 dye (Sigma-Aldrich), then purified by HPLC as previously described (Raj et al., 2008 (link)). To visualize the 5' and 3' halves of oskar, 48 oligos from the complete probe set covering the 5' half of oskar were coupled to Atto 565 dye and 48 oligos covering the 3' half were coupled to Atto 647N dye. The sfgfp probe set was purchased already conjugated to Quasar 670 dye (Biosearch Technologies). smFISH was performed as described in Abbaszadeh and Gavis (2016) (link). Embryos were mounted under #1.5 glass coverslips (VWR) in Vectashield Mountant (Vector Laboratories) for quantification of total localized fluorescence intensity or Prolong Diamond Antifade Mountant (Thermo Fisher Scientific) for colocalization and particle intensity analyses.
7
Synthesis and Structural Characterization of 2'F-Py-Containing RNA Aptamers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this step, 2′F-Py-containing RNAs, either unmodified or conjugated at 5′ extremity with biotin or fluorescent Quasar 670 dye, were synthesized by LGC Biosearch Technologies (Risskov, Denmark, sTN145, sTN58, Scr) or Integrated DNA Technologies, Inc. (Coralville, IA, USA, sTN29a and sTN29b). Aptamers were internally labeled with Alexa Fluor 647, as previously reported [11 (link)]. The sequences of truncated and full-length correspondent aptamers are reported in Supplementary Table S1 . Scr, used as a negative control, has the following sequence: 5′UUCGUACCGGGUAGGUUGGCUUGCACAUAGAACGUGUCA3′.
Before each use, the aptamers dissolved in RNAse-free water at a final concentration of 20 µM were subjected to a heating and cooling step (85 °C for 5 min, on ice for 3 min, 37 °C for 10 min) for ensuring their proper folding.
The secondary structures were predicted by using ViennaRNA Web Services (RNAfold web server,http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi , accessed on 10 January 2022); RNAstructure version 6.2 and the Mfold online web server (http://www.unafold.org/mfold/applications/rna-folding-form.php , accessed on 10 January 2022).
Before each use, the aptamers dissolved in RNAse-free water at a final concentration of 20 µM were subjected to a heating and cooling step (85 °C for 5 min, on ice for 3 min, 37 °C for 10 min) for ensuring their proper folding.
The secondary structures were predicted by using ViennaRNA Web Services (RNAfold web server,
8
Multimodal Characterization of Mouse Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stellaris oligonuleiotide probe sets (20-mers) that cover the entire lengths of 12S mtrRNA and 16S mtrRNA were synthesized and tagged with Quasar 570 Dye and Quasar 670 Dye (Biosearch Technologies, Petaluma, CA, USA) respectively. Collected mouse embryos were fixed and stained with 125 nM Stellaris probes, either singly or together. Stained embryos were then mounted onto glass slides.
For immunostaining of embryos with antibodies, embryos were fixed with 4% paraformaldehyde (PFA)/PBST (1! PBS containing 0.1% Triton X-100), for 15 min. After washing twice with PBST, they were blocked in 2% BSA/PBST for 2 h and incubated with primary antibodies for 2 h. Fluorescently tagged secondary antibodies were then used to stain the embryos in 1% BSA/PBST for another 2 h. Nuclei were stained with 4 0 , 6-diamidino-2-phenylindole dihydrochloride (DAPI) (0.5 mg/ml) for 3 min. Stained embryos were washed three times with PBST and mounted onto glass slides in 50% glycerol/PBS.
For immunostaining of embryos with antibodies, embryos were fixed with 4% paraformaldehyde (PFA)/PBST (1! PBS containing 0.1% Triton X-100), for 15 min. After washing twice with PBST, they were blocked in 2% BSA/PBST for 2 h and incubated with primary antibodies for 2 h. Fluorescently tagged secondary antibodies were then used to stain the embryos in 1% BSA/PBST for another 2 h. Nuclei were stained with 4 0 , 6-diamidino-2-phenylindole dihydrochloride (DAPI) (0.5 mg/ml) for 3 min. Stained embryos were washed three times with PBST and mounted onto glass slides in 50% glycerol/PBS.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!