Amaxa nucleofection kit

Conditionally immortalized mouse podocytes in culture were a gift from Stuart Shankland (University of Washington, Seattle, Washington, USA) and cultured under permissive conditions as described previously (49 (link)). Briefly, cells were cultured in RPMI 1640 medium containing 10% FBS, 0.075% sodium bicarbonate (Sigma-Aldrich), 1 mM sodium pyruvate, 100 U/mL penicillin, and 100 μg/mL streptomycin in a humidified incubator with 5% CO₂. Cells were cultured at 33°C with 50 U/mL recombinant mouse IFN-γ (Millipore) on collagen type I–coated plastic Petri dishes and were transferred to a 37°C incubator without IFN-γ to induce differentiation. Conditionally immortalized podocytes were transfected by using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer’s instructions. Transient transfection of primary podocytes was conducted via electroporation by using an Amaxa Nucleofection kit (Lonza Bioscience) as previously described (60 (link)). The transfection efficiency was evaluated based on HA expression.

To express EGFP-LacR fusion proteins under control of the EEF1A1 promoter, we replaced the DsRed gene of the phage2-EEF1A1-DsRed-IRES vector (gift from Niels Geijsen) by the coding regions of EGFP-lacR (a gift from Pernette Verschure) using the NotI and BamHI sites. The chromodomain was PCR-amplified from full-length Cbx1 and put behind lacR. The threonine-to-alanine mutation at residue 34 of the chromodomain was done using the QuickChange site-directed mutagenesis II kit (Stratagene). Transgenic cells were transfected using the Amaxa nucleofection kit (Lonza) as detailed in experimental procedures. GFP-positive cells were FACS-sorted 72 h after nucleofection on a FACSAria (BD Biosciences) while simultaneously measuring mCherry expression. For chromatin immunoprecipitation, cells were transduced with lentiviruses of the same constructs and expanded for 10 d under puromycin selection (see Supplemental Methods for details).

The myc-tagged NSun2 C271A mutated construct (Hussain et al, 2009 (link)) or an empty vector control were transfected into human fibroblasts using an Amaxa nucleofection kit (Lonza), and cells were harvested 48 h later. miCLIP was subsequently performed as described previously (Hussain et al, 2013b (link)).

For miR-20a overexpression studies, a BLOCK-iT Pol II miR RNAi Expression Vector Kit (Invitrogen) was used to generate a vector coding for either miR-20a or a miR-control. The pre-miR-20a sequence was derived from the miRBase database (http://microrna.sanger.ac.uk/) and was chemically synthesized (Biomers.net). The pre-miR-20a sequence additionally includes overhangs for cloning into the pcDNA 6.2-GW/EmGFP-miR vector (Invitrogen). The following sequences were designed: Top strand: 5’-GTAGCACTAAAGTGCTTA TAGTGCAAGTAGTGTTTAGTTATCTACT GCATTATGAGCACTTAAAGTACTGC-3’.
Bottom strand: 3’–GCAGTACTTTAAGTGCTCATAATGCAGTAGATAACTAAACAC TA CCTGCACTATAAGCACTTTAGTGCTA-5’. A negative control plasmid was included in the BLOCK-iT Pol II miR RNAi Expression Vector Kit (Invitrogen). For overexpression, 1 x 10⁶ human naïve CD4⁺ T cells were transfected with 1 μg of either miR-control or miR-20a expressing plasmids using AMAXA nucleofection kit (Lonza) according to the manufacturer’s instructions. After transfection T-cells were transferred to 6-well culture plates containing RPMI 1640 medium (Biochrome) supplemented with 10% FCS and 2 μg/mL Ciprobay and incubated for 16 h before use.