Pyromark q24 advanced instrument

The bisulfite-treated DNA was amplified by PCR using Platinum PCR Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA). Primers (5’−3’): forward (GTGGTTTTGTTTTGTTGTTAGAGAG), reverse (biotin-AAAATTCCCTAAAATTAAAAACTTCT) and sequencing (TGTTTTGTTGTTAGAGAGA) are designed with PyroMark Assay Design SW 2.0 software and obtained from Integrated DNA Technologies (Coralville, Iowa). Specifically, the reverse primer was biotinylated at the 5’ end. The biotinylated PCR product was captured using streptavidin-coated beads (GE Healthcare, Piscataway, NJ, USA). After annealing with the sequencing primer, the single-stranded PCR product was pyrosequenced on a PyroMark Q24 advanced instrument (Qiagen). Average Methylation Index (MI) is calculated by combining the percentage of each CpG peak and dividing with the total number of CpG peaks in the pyrogram as previously shown [23 (link)].

The bisulfite-treated DNA was amplified by PCR using Platinum PCR Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) with the forward and reverse primers listed in Supplementary Table 1. Specifically, the reverse primers were biotinylated at the 5’ end. The PCR product was separated by agarose gel electrophoresis and was visualized by ethidium bromide staining using a Gel Documentation 2000 system (Bio-Rad, Hercules, CA, USA) to ensure purity of the PCR products. Later, the biotinylated PCR product was captured using streptavidin-coated beads (GE Healthcare, Piscataway, NJ, USA). After annealing with the sequencing primer at 80°C for 5 min, the single-stranded PCR product was pyrosequenced on a PyroMark Q24 advanced instrument (Qiagen).