H1975-Cas9 cells were generated with pLenti-EF1a-Cas9 lentiviral particles (ABM, Cat #K003) and maintained in 0.5 μg/ml puromycin in DMEM containing with 10% FBS. H1975-Cas9-intergrated cells were seeded in a 96-well plate at 3,000 cells per well one day prior to transfection. Edit-R-synthetic crRNA (CRISPR RNA) targeting MIR147B (GE Healthcare Dharmacon, Cat #crRNA-413428, 413429, 413430 and 413431), non-targeting control (Cat #U-007501–01-20) and tracrRNA (trans-activating CRISPR RNA) (Cat #U-002005–20) were individually resuspended in 10 mM Tris-HCl pH7.5 to a concentration of 100 µM. crRNA and tracrRNA were obtained at equimolar ratio and diluted to 2.5 μM using 10 mM Tris-HCl pH7.5. A final concentration of 50 nM crRNA:tracrRNA complex was used for transfection. Cells were transfected using 0.4 µL/well of DharmaFECT Duo transfection reagent (GE Healthcare Dharmacon, Cat #T-2010–02). hsa-miR-147b targeting sequences: crRNA 1: 5’ AGAGTACTCTATAAATCTAG 3’, crRNA 2: 5’ TTTCTGCACAAACTAGATTC 3’, crRNA 3: 5’ AGATTCTGGACACCAGTGTG 3’, and crRNA 4: 5’ GCAGAAGCATTTCCGCACAC 3’.
Plenti ef1a cas9 lentiviral particles
Manufactured by Applied Biological Materials
PLenti-EF1a-Cas9 lentiviral particles are a laboratory tool used to deliver the Cas9 gene, which is a key component of the CRISPR-Cas9 genome editing system, into target cells. The particles are produced using lentiviral vector technology and contain the Cas9 gene under the control of the constitutive EF1a promoter.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using plenti ef1a cas9 lentiviral particles
1
CRISPR-Cas9 Targeting of MIR147B in H1975 Cells
2
CRISPR-Cas9 Targeting of MIR147B in H1975 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H1975-Cas9 cells were generated with pLenti-EF1a-Cas9 lentiviral particles (ABM, Cat #K003) and maintained in 0.5 μg/ml puromycin in DMEM containing with 10% FBS. H1975-Cas9-intergrated cells were seeded in a 96-well plate at 3,000 cells per well one day prior to transfection. Edit-R-synthetic crRNA (CRISPR RNA) targeting MIR147B (GE Healthcare Dharmacon, Cat #crRNA-413428, 413429, 413430 and 413431), non-targeting control (Cat #U-007501–01-20) and tracrRNA (trans-activating CRISPR RNA) (Cat #U-002005–20) were individually resuspended in 10 mM Tris-HCl pH7.5 to a concentration of 100 µM. crRNA and tracrRNA were obtained at equimolar ratio and diluted to 2.5 μM using 10 mM Tris-HCl pH7.5. A final concentration of 50 nM crRNA:tracrRNA complex was used for transfection. Cells were transfected using 0.4 µL/well of DharmaFECT Duo transfection reagent (GE Healthcare Dharmacon, Cat #T-2010–02). hsa-miR-147b targeting sequences: crRNA 1: 5’ AGAGTACTCTATAAATCTAG 3’, crRNA 2: 5’ TTTCTGCACAAACTAGATTC 3’, crRNA 3: 5’ AGATTCTGGACACCAGTGTG 3’, and crRNA 4: 5’ GCAGAAGCATTTCCGCACAC 3’.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!