Log In Sign up
The largest database of trusted experimental protocols

Rnase free dnase 1

Manufactured by Zymo Research
Visit Supplier

RNase-free DNase I is a highly purified deoxyribonuclease enzyme that specifically digests DNA, leaving RNA intact. It is optimized for use in RNA isolation and other molecular biology applications where the removal of contaminating DNA is required.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (4 mentions) Direct zol rna miniprep kit, by Zymo Research (3 mentions) Fxr1p antibody, by Santa Cruz Biotechnology (2 mentions) Anti mouse igg, by Santa Cruz Biotechnology (2 mentions) Superscript 4, by Thermo Fisher Scientific (2 mentions) Revertaid reverse transcriptase kit, by Thermo Fisher Scientific (2 mentions) Ribolock rnase inhibitor, by Thermo Fisher Scientific (2 mentions) Pcr clean up system, by Promega (2 mentions) Protoscript 2 reverse transcriptase reaction, by New England Biolabs (2 mentions) Protoscript 2 reverse transcriptase, by New England Biolabs (2 mentions) Wizard sv gel, by Promega (2 mentions) M mlv rt, by Thermo Fisher Scientific (2 mentions) Lightcycler 96 real time pcr machine, by Roche (2 mentions) Rnaseout, by Thermo Fisher Scientific (2 mentions) Sygreen blue mix, by PCR Biosystems (2 mentions) Quick rna miniprep kit, by Zymo Research (2 mentions) Stranded total rna prep ligation with ribo zero plus, by Illumina (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Ec3 digital camera, by Leica camera (1 mentions) M165fc fluorescent stereomicroscope, by Leica camera (1 mentions)

12 protocols using rnase free dnase 1

1

RIP Assay for FXR1P Binding

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RIP was performed according to previously published protocols with some modifications63 (link). Cells were harvested on the second day of minigene transfection in RIP buffer (25 mM Tris-HCl, at pH 7.4, 150 mM KCl, 5 mM EDTA, 0.5% NP-40 and 0.5 mM DTT supplemented with complete protease inhibitor cocktail and 100 U ml-1 RNase OUT), sonicated (10 s three times with 1 min intervals) and centrifuged at 13,000 rpm for 10 min at 4 °C. Supernatant was treated with 100 U RNase-free DNase I (Zymo Research, E1011-A) at 37 °C for 30 min and then centrifuged again at 13,000 rpm for 10 min at 4 °C. For immunoprecipitation, lysates were incubated with FXR1P antibody (Santa Cruz, sc-374148) or anti-mouse IgG (Santa Cruz, sc-2025) as a negative control overnight at 4 °C. The Dynabeads were washed three times with the RIP buffer and bound RNA was isolated using TRIzol (Thermo Fisher Scientific, 15596018), according to the manufacturer’s instructions. Eluted RNA was reverse-transcribed using SuperScript IV (Thermo Fisher Scientific, 18090050) with random hexamer primers. PCR was carried out for 30 cycles, consisting of 30 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C. PCR products were analyzed by agarose gel electrophoresis.
Tran S.S., Jun H.I., Bahn J.H., Azghadi A., Ramaswami G., Van Nostrand E.L., Nguyen T.B., Hsiao Y.H., Lee C., Pratt G.A., Martínez-Cerdeño V., Hagerman R.J., Yeo G.W., Geschwind D.H, & Xiao X. (2018). Widespread RNA editing dysregulation in brains from autistic individuals. Nature neuroscience, 22(1), 25-36.
+ Open protocol
+ Expand
2

Transcriptomic Analysis of Mycobacterium tuberculosis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Mtb H37Rv and NCG grown in Middlebrook 7H9 media were harvested at an OD600 of 1 and the pellets were resuspended in TRIzol reagent (Invitrogen). The suspended bacterial pellets were then lysed using 0.7 mm zirconia beads as described previously. Subsequently, bacterial RNA was isolated using the Direct-zol RNA Miniprep kit (Zymo Research) and treated with RNAse-free DNAse I (NEB). Library prep using Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Illumina) was performed by the Duke Center for Genomic and Computational Biology (GCB). The prepared libraries were subsequently sequencing using the NextSeq 500 High-Output platform to generate 75 bp single-end reads.
Transcript abundances were quantified using Kallisto v0.48113 (link) in single-end mode, with an estimated fragment length of 250 and a SD of 35, and sequence based bias correction. H37Rv cDNA was used as the index for pseudoalignment. Visualization of the data was done in RStudio using Sleuth v0.30.0.110 (link) Raw reads deposited at NCBI in Bioproject PRJNA872173.
Saelens J.W., Sweeney M.I., Viswanathan G., Xet-Mull A.M., Jurcic Smith K.L., Sisk D.M., Hu D.D., Cronin R.M., Hughes E.J., Brewer W.J., Coers J., Champion M.M., Champion P.A., Lowe C.B., Smith C.M., Lee S., Stout J.E, & Tobin D.M. (2022). An ancestral mycobacterial effector promotes dissemination of infection. Cell, 185(24), 4507-4525.e18.
+ Open protocol
+ Expand
3

RNA Extraction and cDNA Synthesis from Maize Leaves

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the 2nd youngest leaves of Z. mays seedlings exposed to water deficit or treated with 50 µM ABA or from the control treatments. Leaf material was ground to a fine powder in liquid nitrogen. Total RNA was isolated from 50 mg of ground plant material using the Direct-Zol™ RNA miniprep kit (Zymo Research) according to the instructions of the manufacturer. RNase-free DNase I (Zymo Research) was used to remove DNA from the isolated RNA as specified by the manufacturer. RiboLock® RNase Inhibitor (Thermo Scientific) was added to prevent RNase-mediated degradation of the RNA. First strand cDNA synthesis was carried out using 500 ng of total RNA and the RevertAid™ Reverse Transcriptase kit (Thermo Scientific) as specified by the manufacturer.
Phillips K, & Ludidi N. (2017). Drought and exogenous abscisic acid alter hydrogen peroxide accumulation and differentially regulate the expression of two maize RD22-like genes. Scientific Reports, 7, 8821.
+ Open protocol
+ Expand
4

Verification of Transgenic Actin Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transgenic actin expression was verified by isolating total RNA from bisected thoraces or dissected IFMs of 10 Mef2-GAL4> UAS-Act57BWT, UAS-Act57BK326Q, UAS-Act57BK328Q, or UAS-Act57BK326Q/K328Q flies using the Quick-RNA microprep kit (Zymo Research Corp). Contaminating DNA was removed with RNase free DNase I (Zymo Research Corp). One step RT-PCR was carried out with the Qiagen QuantiTect Reverse Transcription Kit (Qiagen Inc) and 10 ng RNA per reaction. The cDNA was amplified using an Act57B primer pair (5′ CCCTGTACGCCTCCGGTCGTA 3′ and 5′ TTAGAAGCACTTGCGGTGGAC 3′) and the amplified product was sequenced at the Johns Hopkins Synthesis and Sequencing facility.
Transgenic muscle-restricted protein expression was confirmed using the UAS-Act57BGFP.WT reporter line in conjunction with either the MHC-GAL4 or Mef2-GAL4 drivers. Two-day-old adult progeny were imaged using a Leica M165FC fluorescent stereo microscope and a Leica EC3 digital camera.
Viswanathan M.C., Blice-Baum A.C., Schmidt W., Foster D.B, & Cammarato A. (2015). Pseudo-acetylation of K326 and K328 of actin disrupts Drosophila melanogaster indirect flight muscle structure and performance. Frontiers in Physiology, 6, 116.
+ Open protocol
+ Expand
5

Maize Leaf RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the maize leaf samples (50 mg each) using the Direct-Zol™ RNA miniprep kit (Zymo Research) according to the instructions from the manufacturer. RNase-free DNase I (Zymo Research) was used to remove DNA from the isolated RNA as specified by the manufacturer. RiboLock® RNase Inhibitor (Thermo Scientific) was added to each RNA sample to prevent RNase-mediated degradation of the RNA. First strand cDNA synthesis was carried out using 500 ng of total RNA and the RevertAid™ Reverse Transcriptase kit, with an Oligo(dT) 18 Primer (Thermo Scientific) as specified by the manufacturer.
Phillips K., Majola A., Gokul A., Keyster M., Ludidi N, & Egbichi I. (2018). Inhibition of NOS- like activity in maize alters the expression of genes involved in H2O2 scavenging and glycine betaine biosynthesis. Scientific Reports, 8, 12628.
+ Open protocol
+ Expand
6

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from 75 roots of 18-d-old plants per genotype/treatment using the RNeasy Plant Mini Kit (Qiagen) and treated with RNase-free DNaseI (Zymo Research). First strand cDNA was synthesized from 2.5 μg of total RNA using SUPERSCRIPTTM II reverse transcriptase (Invitrogen) according to the manufacturer’s instructions.
Valenzuela C.E., Acevedo-Acevedo O., Miranda G.S., Vergara-Barros P., Holuigue L., Figueroa C.R, & Figueroa P.M. (2016). Salt stress response triggers activation of the jasmonate signaling pathway leading to inhibition of cell elongation in Arabidopsis primary root. Journal of Experimental Botany, 67(14), 4209-4220.
+ Open protocol
+ Expand
7

RIP Assay for FXR1P Binding

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RIP was performed according to previously published protocols with some modifications63 (link). Cells were harvested on the second day of minigene transfection in RIP buffer (25 mM Tris-HCl, at pH 7.4, 150 mM KCl, 5 mM EDTA, 0.5% NP-40 and 0.5 mM DTT supplemented with complete protease inhibitor cocktail and 100 U ml-1 RNase OUT), sonicated (10 s three times with 1 min intervals) and centrifuged at 13,000 rpm for 10 min at 4 °C. Supernatant was treated with 100 U RNase-free DNase I (Zymo Research, E1011-A) at 37 °C for 30 min and then centrifuged again at 13,000 rpm for 10 min at 4 °C. For immunoprecipitation, lysates were incubated with FXR1P antibody (Santa Cruz, sc-374148) or anti-mouse IgG (Santa Cruz, sc-2025) as a negative control overnight at 4 °C. The Dynabeads were washed three times with the RIP buffer and bound RNA was isolated using TRIzol (Thermo Fisher Scientific, 15596018), according to the manufacturer’s instructions. Eluted RNA was reverse-transcribed using SuperScript IV (Thermo Fisher Scientific, 18090050) with random hexamer primers. PCR was carried out for 30 cycles, consisting of 30 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C. PCR products were analyzed by agarose gel electrophoresis.
Tran S.S., Jun H.I., Bahn J.H., Azghadi A., Ramaswami G., Van Nostrand E.L., Nguyen T.B., Hsiao Y.H., Lee C., Pratt G.A., Martínez-Cerdeño V., Hagerman R.J., Yeo G.W., Geschwind D.H, & Xiao X. (2018). Widespread RNA editing dysregulation in brains from autistic individuals. Nature neuroscience, 22(1), 25-36.
+ Open protocol
+ Expand
8

RNA-seq Library Preparation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was treated with RNase-free DNase I (Zymo Research Corporation) to remove any genomic DNA contamination, followed by phenol/chloroform extraction and ethanol precipitation. For cDNA synthesis, 2 μg DNase I-treated total RNA was annealed with 100 pmol oligo d(T)25 DNA primer in the presence of 10 pmol each dNTP by incubation at 65 °C for 3 min and quickly cooled on ice. A 20 μl reverse-transcription reaction was performed in 1X ProtoScript II Reverse Transcriptase Reaction buffer (50 mM Tris-HCl pH 8.3, 75 mM KCl and 3 mM MgCl2), 10 mM DTT and 200 U ProtoScript II Reverse Transcriptase (New England Biolabs) at 48°C for 30 min. The reaction was terminated by incubation at 80°C for 5 min. PCR was performed in a 25 μl reaction with 1 μl of ½ X diluted reverse-transcription reaction in 1X Q5 Reaction buffer (25 mM TAPS-HCl pH 9.3, 50 mM KCl, 2 mM MgCl2 and 1 mM β-mercaptoethanol), 0.2 mM each dNTP, 0.5 U of Q5 DNA Polymerase, 0.2 μM forward primer (5′-CACAACACTCAAACCACTTTCAC-3′) and 0.2 μM reverse (5′-TGTTCGACACCGGTCACACT-3′) primer. PCR products were resolved on a 3% agarose gel. The DNA bands corresponding to the spliced products were gel extracted using Wizard SV gel and PCR clean-up system (Promega) and sequenced.
Qi X., Rand D.P., Podlevsky J.D., Li Y., Mosig A., Stadler P.F, & Chen J.J. (2015). Prevalent and distinct spliceosomal 3′-end processing mechanisms for fungal telomerase RNA. Nature communications, 6, 6105.
+ Open protocol
+ Expand
9

RNA-seq Library Preparation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was treated with RNase-free DNase I (Zymo Research Corporation) to remove any genomic DNA contamination, followed by phenol/chloroform extraction and ethanol precipitation. For cDNA synthesis, 2 μg DNase I-treated total RNA was annealed with 100 pmol oligo d(T)25 DNA primer in the presence of 10 pmol each dNTP by incubation at 65 °C for 3 min and quickly cooled on ice. A 20 μl reverse-transcription reaction was performed in 1X ProtoScript II Reverse Transcriptase Reaction buffer (50 mM Tris-HCl pH 8.3, 75 mM KCl and 3 mM MgCl2), 10 mM DTT and 200 U ProtoScript II Reverse Transcriptase (New England Biolabs) at 48°C for 30 min. The reaction was terminated by incubation at 80°C for 5 min. PCR was performed in a 25 μl reaction with 1 μl of ½ X diluted reverse-transcription reaction in 1X Q5 Reaction buffer (25 mM TAPS-HCl pH 9.3, 50 mM KCl, 2 mM MgCl2 and 1 mM β-mercaptoethanol), 0.2 mM each dNTP, 0.5 U of Q5 DNA Polymerase, 0.2 μM forward primer (5′-CACAACACTCAAACCACTTTCAC-3′) and 0.2 μM reverse (5′-TGTTCGACACCGGTCACACT-3′) primer. PCR products were resolved on a 3% agarose gel. The DNA bands corresponding to the spliced products were gel extracted using Wizard SV gel and PCR clean-up system (Promega) and sequenced.
Qi X., Rand D.P., Podlevsky J.D., Li Y., Mosig A., Stadler P.F, & Chen J.J. (2015). Prevalent and distinct spliceosomal 3′-end processing mechanisms for fungal telomerase RNA. Nature communications, 6, 6105.
+ Open protocol
+ Expand
10

Relative SERINC5 and SERINC3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total cellular RNA was extracted from 1 × 106 JTAg WT, JTAg S3/S5 KO, CEM WT, CEM S5KO (8), CEM S5KO (11), and CEM S3/S5 KO (9) cells using a Quick-RNA miniprep kit (Zymo Research), followed by treatment with RNase-free DNAse I (Zymo Research). Complementary DNA (cDNA) was generated from 250 ng of all extracted RNA samples using M-MLV RT (Thermo Fisher Scientific) and treated with RNaseOUT (Thermo Fisher Scientific). cDNA was mixed with the respective primer pairs and SyGreen Blue Mix (PCR Biosystems) following the manufacturer’s protocol in biological triplicate and performed using a LightCycler 96 real-time PCR machine (Roche). Quantification cycle values were normalized to a reference gene (GAPDH) and relative SERINC5 or SERINC3 gene expression ratios were calculated using the 2−ΔΔCt method (Schmittgen and Livak, 2008 (link)). The following primers were used for analysis: SERINC5: 5′-ATCGAGT TCTGACGCTCTGC-3′ and 5′-GCTCTTCAGTGTCCTCTCCAC-3’; SERINC3 5′-AATTCAGGAACACCAGCCTC-3′ and 5′- GGTTGGGATTGCAGGAAC GA-3’; GAPDH 5′-TGCACCACCAACTGCTTAGC-3′ and 5′-GGCATGGACT GTGGTCATGAG-3’.
Ramirez P.W., Vollbrecht T., Acosta F.M., Suarez M., Angerstein A.O., Wallace J., O’ Connell R.M, & Guatelli J. (2022). Nef enhances HIV-1 replication and infectivity independently of SERINC5 in CEM T cells. Virology, 578, 154-162.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!