Cells were transfected using a Lonza Nucleofector 2b device using the Amaxa Cell line Nucleofector Kit V (Cat. No. VCA-1003). Briefly, 5 × 106 cells were harvested by spinning down at 90 ×g for 10 min; 5 µg of plasmid was mixed with Nucleofector solution and supplement following the manufacturer’s protocol and then added to the pelleted cells. Cells were then transfected using the Nucleofector program M-013 and placed into warm media for overnight incubation. After 24 h, cells were stimulated and imaged on an inverted fluorescence microscope (IX-81; Olympus, Center Valley, PA) set up for TIRF imaging as described in Larson et al. (2014) (link). Only healthy cells expressing levels moderate of transgene were selected for imaging. Previous studies in our lab have found no substantial effects of expression levels on co-localization values across the range of expression levels we commonly use in the lab (Larson et al., 2014 (link); Trexler et al., 2016 (link)).
Nucleofector 2b device
Manufactured by Lonza
Sourced in Switzerland, Germany, United States
The Nucleofector 2b device is a specialized laboratory instrument designed for the efficient transfection of a wide variety of cell types, including hard-to-transfect cells. The device utilizes an optimized electrical pulse technology to facilitate the delivery of nucleic acids, such as DNA or RNA, into the nuclei of cells. The core function of the Nucleofector 2b is to enable researchers to introduce genetic material into cells in a controlled and reproducible manner.
Automatically generated - may contain errors
Lab products found in correlation
Cell line nucleofector kit 5, by Lonza (14 mentions)
Amaxa cell line nucleofector kit 5, by Lonza (9 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (9 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (6 mentions)
Amaxa mouse macrophage nucleofector kit, by Lonza (4 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions)
Facsaria 3, by BD (4 mentions)
Nucleofector kit t, by Lonza (3 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (3 mentions)
Human cd34 cell nucleofector kit, by Lonza (3 mentions)
Puromycin, by Thermo Fisher Scientific (3 mentions)
Opti mem reduced serum media, by Thermo Fisher Scientific (3 mentions)
Nucleofector kit r, by Lonza (3 mentions)
Puromycin, by Merck Group (3 mentions)
Glutamax, by Thermo Fisher Scientific (3 mentions)
Pirespuro2 plasmid construct, by Takara Bio (2 mentions)
Pgl3 basic vector, by Promega (2 mentions)
Matrigel, by Corning (2 mentions)
Dmem f12, by Thermo Fisher Scientific (2 mentions)
N2 supplement, by Thermo Fisher Scientific (2 mentions)
220 protocols using nucleofector 2b device
1
Optimized Plasmid Transfection and Microscopy
2
Generation of Knockout Cell Lines via RNP Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Knockout cells were generated using the ribonucleoprotein (RNP) transfection method. Briefly, MEFs or HT22 cells were transfected by Nucleofection (Nucleofector™ 2b Device; Amaxa) with RNP complexes comprising a 1:1 molar ratio of Alt-R® S. pyogenes HiFi Cas9 Nuclease V3 (Integrated DNA Technologies; IDT) and duplexes of Alt-R CRISPR–Cas9 crRNA and Alt-R CRISPR–Cas9 tracrRNA-ATTOTM 550 (IDT). Gene-specific sequences of crRNAs used were: Psen1 GUAGUCCACGGCGACAUUGUGUUUUAGAGCUAUGCU; Psen2 CAUCUACACGCCCUUCACGGGUUUUAGAGCUAUGCU; Lrp8 – CUGCUCGGACAACAGCGACGGUUUUAGAGCUAUGCU; and Notch1 – GGUAUUCACGCCGUCCACACGUUUUAGAGCUAUGCU. 48 h following transfection, single-cell cloning was performed by the limiting dilution method in 96-well plates. Clones were selected in normal growth media additionally containing 400 nM liproxstatin and 800 nM α-tocopherol quinone to prevent loss of cells due to ferroptosis. 2-weeks later several clones of each KO were identified and expanded for further experiments. Control cells were transfected in parallel under identical conditions with RNPs constructed using negative control (NC) crRNA (murine; IDT). Surviving NC clones were pooled and used as the appropriate control line for the gene-specific knockout clones. Knockout was confirmed via western blotting with at least two different antibodies.
3
Transient Protein Expression in NIH/3T3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transient (over)expression of fluorescently labeled proteins in NIH/3T3 was performed by electroporation using the Nucleofector 2b device (AMAXA). The following inserts/plasmids were used: GFP/VECTOR, GFP-PTEN/VECTOR, mCherry-PTEN-CAAX/Vector [41 (link)] and GFP-TTL (kind gift from C. Hoogenraad laboratory, University Utrecht, Netherlands). Cells were washed 2 times with PBS and detached from the culture dish by using Trypsin-EDTA (1 ml for a 10 cm dish, Gibco) for 5 min at 37°C. The cells were re-suspended in 10 ml of culture medium containing BCS to inactivate the trypsin. Cell density was determinate by counting in a Neubauer chamber. Cells [1 x 106] were centrifuged for 5 min at 5.000 RPM. The cell pellet was re-suspended in 100 μl electroporation buffer and 5 μg of DNA added. The cell—DNA mixture was transferred into the electroporation cuvette and electroporation was performed by using the A-024 program. The treated cells were diluted in 2 ml pre-warmed culture medium containing BCS an added into two 6-well plate dishes containing fibronectin coated glass coverslips. After one hour, the cells were nearly fully attached to the fibronectin coated coverslips. To remove dead cells, the culture medium was changed.
4
SARS-CoV-2 E Protein Expression in THP-1 Monocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
THP-1 monocytes were nucleofected with the GFP or SARS-CoV-2–E protein–GFP coding pcDNA3.1 plasmids using the Amaxa Cell Line Nucleofector Kit V-Lonza and Nucleofector 2b Device (Amaxa). In another set of experiments, THP-1 monocytes were cotransfected with SARS-CoV-2–E protein–GFP–pcDNA3.1 and pmCherry-N1 or TMEM176B-pmCherry-N1 plasmids. Sixteen hours later, cells were treated for 24 hours with lipopolysaccharide (0.25 μg/ml). Supernatants were collected to determine IL-1β by ELISA, and cell viability was assessed by flow cytometry using DAPI (4′,6-diamidino-2-phenylindole).
5
Cultivation and Transfection of Parasitic Protozoa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Epimastigotes of the T. cruzi strain Silvio X10/7 (MHOM/BR/78/Silvio; clone X10/7) clone A1 were grown RTH/FCS medium at 28°C [24 (link)]. T. brucei bloodstream-form parasites were grown in an HMI9-T [25 (link)] medium at 37°C and Leishmania donovani (MHOM/SD/62/1S-CL2D) promastigotes were grown in a modified M199 medium described previously [26 (link)]. Transgenic parasites overexpressing NTR1 (TCSYLVIO_001958) were generated by transfection of plasmid pTREX-TcNTR1 with an Amaxa Nucleofector 2b device using program U-33. Transgenic parasites were selected by the addition of G418 at 250 µg ml−1.
6
Cultivation and Transfection of T. brucei
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T. brucei PCF 29–13 [21 (link)], and SmOxP927 [86 (link)] cell lines co-expressing T7 RNA polymerase (T7RNAP) and the Tet repressor (TetR) are referred to as wild-type in this study. The conditions for cultivation have been described elsewhere [87 (link),88 (link)]. BSF cells used throughout were the single marker strain that constitutively expresses T7RNAP and TetR [21 (link)], and were grown in Hirumi modified Iscove’s medium 11 (HMI-11) [89 (link)] supplemented with G418 (2.5 μg mL-1). BSF were grown at 37°C with 5% (v/v) CO2 in humidified atmosphere and kept at cell densities of 1 x 105 to 2 x 106 cells mL-1 and diluted with fresh HMI-11 media as required.
For transfections, 10 μg of linearised constructs (see below) were electroporated into 1 x 107 to 2 x 107 cells using an Amaxa Nucleofector 2b device or BTX electroporator, as previously described [87 (link),88 (link)]. Stable transformants were selected by clonal dilution in media containing the appropriate selection drugs.
For transfections, 10 μg of linearised constructs (see below) were electroporated into 1 x 107 to 2 x 107 cells using an Amaxa Nucleofector 2b device or BTX electroporator, as previously described [87 (link),88 (link)]. Stable transformants were selected by clonal dilution in media containing the appropriate selection drugs.
7
CRISPR-Cas9 Knockout of MSLN
8
CRISPR-Cas9 Mediated Gene Editing in Leishmania
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The LdBPK_061160 gene was targeted by CRISPR-Cas9 mediated deletion using the approach previously described (68 (link)) with the primers documented in Table 1 , and correct targeting by CRISPR-Cas9 was assessed by PCR. The open reading frames (ORFs) of LdBPK_061160 and T. cruzi were amplified using primers designed against TcCLB.508173.240 from T. cruzi Silvio X10/7 genomic DNA, with primers containing engineered NheI and XhoI endonuclease restriction sites (Table 1 ). The purified PCR products and the plasmid PTBLE were digested with NheI and XhoI and the ORFs ligated into the linearized plasmid yielding PTBLE-LdBK_061160 and PTBLE-TcPBN1, respectively. SwaI-digested plasmids were electroporated into mid-log-phase promastigotes using an Amaxa Nucleofector 2b device as previously described (68 (link)). Transgenic parasites were selected by the addition of phleomycin (20 μg mL−1) until parasites in a no-plasmid control transfection had died. cDNAs encoding HsPIG-X and HsPIG-M were amplified using specific primers (Table 1 ) from plasmids carrying genes NM_017861.3 and NM_145167.2 (Sino Biological), and the PCR products were cloned into PTBLE and pRIB expression plasmids using standard restriction enzyme methods (69 (link)).
9
CHO Cell Genetic Construct Integration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the genetic constructs containing the PuroR gene, CHO Flp-In cells were transfected with plasmid DNA (up to 5 µg) using the Lipofectamine 3000 reagent (Life Technologies, L3000008) according to the manufacturer protocol. Plasmid DNA for mNF-GFP and mPF-GFP was introduced into cells using the NucleofectorTM 2b device (Lonza, Walkersville, MD), per manufacturer protocol, using 5–10 × 106 cells, plasmid DNA (1–5 µg), and relevant buffers (Solution T, and program V-23). Site-specific integration of synthetic gene circuits was achieved by co-transfecting the pOG44 plasmid expressing Flp-recombinase with the Flp-expression vectors that encode an FRT-tagged Hygromycin B resistance gene without a start codon. Upon selecting with Hygromycin B, the resistance gene acts as a positive-selection promoter trap, which provides the resistance gene with a start codon only upon successful integration at the genomic FRT site, thus leading to survival. The clonal CHO populations were derived from bulk-transfected cells by fluorescence-activated cell sorting (FACS).
10
Overexpression of Cx43 in Chondrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cx43 was overexpressed, as previously described [2 (link)], in the T/C-28a2 chondrocyte cell after transfection with a pIRESpuro2 plasmid construct (Clontech) containing the human Cx43 sequence, kindly provided by Arantxa Tabernero (INCL, University of Salamanca, Spain). Electroporation was performed with the Amaxa® Cell Line Nucleofector® Kit V (Lonza) in a NucleofectorTM 2b device (Lonza) following the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!