pT7-FLuc-A50, pT7-PV-FLuc-A50, and pT7-EMCV-FLuc-A50 were linearized with NotI and transcribed with HiScribe T7 High yield RNA Synthesis Kit according to manufacturer's instructions (New England Biolabs). For NanoLuc reporters with differing 5′ UTR lengths, pNL1.1 (Promega) was used as a PCR template. Forward primers contained a T7 promoter for transcription and were positioned to generate the indicated 5′ UTR length. Reverse primer added a synthetic poly(A) tail. RNAs was transcribed with HiScribe T7 High yield RNA Synthesis Kit according to manufacturer's instructions (New England Biolabs). In vitro translation assays were performed as previously described (4 (link)).
Hiscribe t7 high yield rna synthesis kit
Manufactured by New England Biolabs
Sourced in United States, United Kingdom, China, Morocco
The HiScribe T7 High Yield RNA Synthesis Kit is a lab equipment product designed for the in vitro transcription of RNA. It contains the necessary reagents to synthesize high yields of RNA from DNA templates using the T7 RNA polymerase. The kit provides a simple and efficient method for the production of RNA for a variety of applications.
Automatically generated - may contain errors
Lab products found in correlation
Monarch rna cleanup kit, by New England Biolabs (31 mentions)
Dnase 1, by New England Biolabs (24 mentions)
Rneasy mini kit, by Qiagen (17 mentions)
Megaclear transcription clean up kit, by Thermo Fisher Scientific (17 mentions)
Nanodrop, by Thermo Fisher Scientific (14 mentions)
Turbo dnase, by Thermo Fisher Scientific (12 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (12 mentions)
Rna clean concentrator kit, by Zymo Research (11 mentions)
Dnase 1, by Thermo Fisher Scientific (11 mentions)
E coli poly a polymerase, by New England Biolabs (9 mentions)
Cleancap ag, by TriLink (9 mentions)
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Cleancap reagent ag, by TriLink (8 mentions)
Rnase free dnase 1, by New England Biolabs (8 mentions)
Cas9 protein, by PNA Bio (7 mentions)
Rna clean and concentrator kit, by Zymo Research (7 mentions)
N1 methylpseudouridine 5 triphosphate, by TriLink (7 mentions)
Rna clean concentrator 25 kit, by Zymo Research (7 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (7 mentions)
Xbai, by New England Biolabs (6 mentions)
372 protocols using hiscribe t7 high yield rna synthesis kit
1
Synthesis and in vitro Translation of Luciferase Reporters
2
CRISPR Editing of CAR T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cas9 mRNA was transcribed in vitro using mMESSAGE mMACHINE T7 ULTRA kits (Life Technologies, AM1345, Carlsbad, CA). gRNA were transcribed using a HiScribeTM T7 High Yield RNA Synthesis Kit (NEB). Cas9 protein was purchased from PNA Bio (CP01).
For the one-shot CRISPR, 20 μg of Cas9 mRNA was mixed with one-shot CAR T cells. For chemical CRISPR, 20 μg of Cas9 mRNA and 10 μg of gRNA were mixed with CAR T cells. For protein CRISPR, 5 μg of Cas9 protein in storage buffer (20 mM HEPES pH 7.5, 150 mM KCl, 1 mM DTT, and 10% glycerol) was mixed with gRNA dissolved in nuclease-free water and incubated for 10 min at room temperature before being mixed with CAR T cells.
Electroporation of CRISPR reagents with one-shot CAR or CAR T cells was performed with a BTX830 electroporator.
Briefly, T cells were washed three times with OPTI-MEM and re-suspended in OPTI-MEM (Invitrogen) at a final concentration of 1–3 × 108 cells/ml. Subsequently, 0.1 ml of the cells was mixed with IVT RNA and electroporated in a 2 mm cuvette. Twenty micrograms of Cas9 mRNA was electroporated into the cells using a BTX830 (Harvard Apparatus BTX) at 360 V and 1 ms. Following electroporation, the cells were immediately placed in 2 ml of pre-warmed culture media and cultured in the presence of IL-2 (100 IU/ml) at 37°C and 5% CO2.
For the one-shot CRISPR, 20 μg of Cas9 mRNA was mixed with one-shot CAR T cells. For chemical CRISPR, 20 μg of Cas9 mRNA and 10 μg of gRNA were mixed with CAR T cells. For protein CRISPR, 5 μg of Cas9 protein in storage buffer (20 mM HEPES pH 7.5, 150 mM KCl, 1 mM DTT, and 10% glycerol) was mixed with gRNA dissolved in nuclease-free water and incubated for 10 min at room temperature before being mixed with CAR T cells.
Electroporation of CRISPR reagents with one-shot CAR or CAR T cells was performed with a BTX830 electroporator.
Briefly, T cells were washed three times with OPTI-MEM and re-suspended in OPTI-MEM (Invitrogen) at a final concentration of 1–3 × 108 cells/ml. Subsequently, 0.1 ml of the cells was mixed with IVT RNA and electroporated in a 2 mm cuvette. Twenty micrograms of Cas9 mRNA was electroporated into the cells using a BTX830 (Harvard Apparatus BTX) at 360 V and 1 ms. Following electroporation, the cells were immediately placed in 2 ml of pre-warmed culture media and cultured in the presence of IL-2 (100 IU/ml) at 37°C and 5% CO2.
3
Synthesis of NAD and m7G-capped RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs containing NAD and m7G cap structures were synthesized by in vitro transcription from synthetic double-stranded DNA template ɸ2.5-NAD-40, ɸ2.5-NAD-75 containing the T7 ɸ2.5 promoter, and a single adenosine within the transcript positioned at the transcription start site (Supplementary Table 3 ). For m7G-capped RNA, m7G-(5′) PPP (5′)-A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction, whereas for NAD-RNA, NAD was used instead of ATP. In vitro transcription was carried out at 37 °C overnight, using HiScribeTM T7 High yield RNA Synthesis kit (New England Biolabs (NEB)). Following in vitro transcription, RNA was purified using Monarch®RNA Cleanup Columns (NEB) as per the manufacturer’s instructions.
4
CRISPR sgRNAs for Acipenser ruthenus dnd1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five single guide RNAs (sgRNAs) were designed to target Acipenser ruthenus dnd1 (Ardnd1) gene. Target sites were, sgSRNA1: GGGGGGAATGCAGTCCAACC; sgRNA2: GGGGGAATGCAGTCCAACC; sgRNA3: TTCAATCATTTTCTTTCTTA; sgRNA4: TGGTTTAAAACCGTAAAGAT and sgRNA5: ATTTTCTGAGTCCATGTTTC. Oligos for sgRNAs were ordered from Macrogen Company (Macrogen Inc., Amsterdam, the Netherlands) and were annealed according to references [41 (link),42 (link)] (Figure S1 ). In vitro transcription (IVT) using HiScribeTM T7 High Yield RNA synthesis kit (NEB) was used to generate sgRNAs, according to manufacturers’ instructions. Synthesized sgRNAs were treated with DNAse to remove any remaining DNA traces and mySPEC spectrophotometer (VWR® mySPEC spectrophotometer) was used for sgRNAs quantification. All sgRNAs were diluted and aliquoted. Cas9 protein was purchased from PNA Bio and was re-suspended as per manufacturers’ instructions, aliquoted and stored at −80 °C.
5
Preparation of D-RNA Library
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The library reaction of 100 μl was prepared consisting of 10 U/μl SSIII reverse transcriptase, 1 mM dNTP mixture and reverse transcription buffer of 1× concentration containing; [1 mM DTT, 4 mM MgCl2, 150 mM LiCl and 20 mM Tris-HCl (pH 7.5)] and 5 μM DNA N40 library template with 5 μM reverse selection primer (Supplementary Table S1 ) were mixed to generate dsDNA (see step 1 Supplementary Figure S1 ). The extension products obtained were column purified (Zymoclean Gel DNA Recovery kit, NEB) and employed as the template dsDNA in a 40 μl T7 in vitro transcription in accordance with the manufacturer’s instruction the NEB’s HiScribeTM ‘T7 High Yield RNA Synthesis Kit’. The reaction mixture was well mixed and incubated for 3.5 h at 37°C, followed by 15 min after the addition of 2 U/μl Turbo DNase. 2× RNA stopping dye (NEB) was added, the samples were heated at 95°C for 3 min and resolved by 12% denaturing polyacrylamide gel electrophoresis (PAGE). Bands of correct size were cut using new razor blade, crushed using sterile pipette tip and incubated at 4°C overnight in 80 μl/well extraction buffer containing 1× Tris-EDTA and 0.8 M LiCl while shaking at 1300 rpm. Zymo RNA clean and concentrator column purification were then followed according to manufacturer’s instructions to obtain the purified D-RNA pool for next step (see step 2 Supplementary Figure S1 ).
6
RNA Benchmarkers Generation and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA benchmarkers were generated by HiScribe TM T7 High Yield RNA Synthesis Kit (NEB #E2040S) from PCR products. Candida albicans transcriptome total RNA was extracted by TRIzol, and the polyA RNA was purified by Poly(A)Purist™ MAG Kit (Thermo Fisher, AM1922).
7
In Vitro Transcription of pCDH-ITSN1-E30 Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Firstly, the pCDH-ITSN1-E30 plasmid was linearized by Xbal and NotI and then the linearized product was used as substrate in the in vitro transcription reaction. In vitro transcription was performed using the HiScribeTM T7 High Yield RNA Synthesis Kit (New England Biolabs) following the manufacturer’s directions.
8
In Vitro Transcription Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HiScribeTM T7 High Yield RNA Synthesis Kit (NEB) was used following manufacturer's manual. Specifically, 100 ng of FLuC positive control template provided by the kit was used for each reaction. 5 μM of purified IFI16 or BSA was added to the reaction mix (to a total of 30 μl) and incubated at 37°C for 4 h. 2 μl of DNase I (NEB) was added to the reaction mix and incubated at 37°C for 15 min. Transcribed RNA was isolated by adding 25 μl of LiCl solution from the kit, incubated at −20°C for 30 min and centrifuged at 15,000 × g, 4°C for 15 min. Pellet was washed with 500 μl of 70% ethanol and centrifuged at 15,000 × g, 4°C for 15 min before being resuspended in 30 μl of water. RNA concentrations were measured using nanodrop.
9
In Vitro Synthesis of NAD- and m7G-Capped RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs containing NAD and m7G cap structures were synthesized by in vitro transcription from a synthetic double stranded DNA template ɸ2.5-NAD-40 containing the T7 ɸ2.5 promoter and a single adenosine within the transcript contained at the transcription start site (Supplementary Table 1 )10 (link). For m7G-capped RNA, m7GpppA RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction. In vitro transcription was carried out at 37 °C overnight, using HiScribeTM T7 High yield RNA Synthesis kit (New England Biolabs).
To generate 32P-labeled NAD-capped RNA, transcription was carried out in the presence of 32P-NAD (PerkinElmer) instead of ATP using ɸ2.5-AG-30 (Supplementary Table1 )10 (link). To generate 32P uniformly labeled RNA, the transcription reactions were performed in the presence of [α-32P] GTP.
To generate 32P-labeled NAD-capped RNA, transcription was carried out in the presence of 32P-NAD (PerkinElmer) instead of ATP using ɸ2.5-AG-30 (Supplementary Table
10
Synthesis of Cap-Modified RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs containing different cap structures were synthesized by in vitro transcription of synthetic double stranded DNA template ϕ2.5-AG-30 containing the T7 ϕ2.5 promoter with an adenosine at the transcription start site (CAGTAATACGACTCACTATT A GCCCTCTCTTCCTTCCTTCCTCCTTTCCT). In vitro transcription was carried out at 37°C overnight, using HiScribeTM T7 High yield RNA Synthesis kit (New England Biolabs).
To generate 5′ end 32P-labeled NAD-capped RNA, ribose ATP was omitted from the reaction and replaced with 32P-NAD (PerkinElmer) to initiate transcription. The resulting RNA contains a single 32P label within the alpha phosphate of the NAD (Npp*A). Similarly, to generate FAD- or dephosphoCoA-capped RNAs containing a 32P-Guanosine at the +2 position, FAD (Sigma) and dephosphoCoA (Sigma) were the only adenosine containing molecules in the mixture to initiate transcription. The reaction was carried out in the presence of [α-32P]GTP to incorporate a single 32P-label at the +2 position within the capped RNA.
To generate 5′ end 32P-labeled NAD-capped RNA, ribose ATP was omitted from the reaction and replaced with 32P-NAD (PerkinElmer) to initiate transcription. The resulting RNA contains a single 32P label within the alpha phosphate of the NAD (Npp*A). Similarly, to generate FAD- or dephosphoCoA-capped RNAs containing a 32P-Guanosine at the +2 position, FAD (Sigma) and dephosphoCoA (Sigma) were the only adenosine containing molecules in the mixture to initiate transcription. The reaction was carried out in the presence of [α-32P]GTP to incorporate a single 32P-label at the +2 position within the capped RNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!