Thapsigargin

Manufactured by Merck Group

Sourced in United States, United Kingdom, Germany, Sao Tome and Principe, Italy, France, Japan, Canada, Spain, Macao, Belgium, Switzerland

Thapsigargin is a naturally occurring compound isolated from the plant Thapsia garganica. It functions as a selective inhibitor of the sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) pump, which is responsible for the active uptake of calcium ions into the endoplasmic reticulum. Thapsigargin is a valuable tool for researchers studying calcium signaling and homeostasis in biological systems.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Thapsigargin (TG, (106 citations) Thapsigargin (T9033) (10 citations) Thapsigargin (Thap) (3 citations) Thapsigargin (TP) (2 citations) Thapsigargin (Thp; (2 citations)

790 protocols using thapsigargin

Monitoring XBP1 splicing under ER stress

Check if the same lab product or an alternative is used in the 5 most similar protocols

Knockdown and rescue were performed as described above. The siRNA-resistant FLAG-STAU1 Flp-In 293 T-REx cell line was grown in 6 well plates, and treated with thapsigargin (SIGMA, T9033) by replacing medium with pre-warmed DMEM supplemented with (10% FBS, 300 nM thapsigargin, 100 ng/μl doxycycline (for RC experiment only)). In order to achieve equal thermal transfer for all samples, plates were always placed directly on incubator shelves. The cells were further incubated for 30 min at 5% CO₂ to induce ER stress. RNA was purified using RNeasy plus mini kit (QIAGEN, 74136). To avoid any systematic error of experimental handling, we performed three independent experiments by varying the order of each condition. In experiment 1, we induced ER stress and lysed cells by the order of UT, KD and RC conditions, experiment 2 using KD, RC and UT, and experiment 3 using RC, UT, KD.
In order to monitor the cytoplasmic splicing of XBP1, RT-PCR and the analysis were performed using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase, X_pr1 (TTACGAGAGAAAACTCATGGC) and X_pr2 (GGGTCCAAGTTGTCCAGAATGC) primers^{38 (link)}, and QIAxcel system as described above except that 100 μg of template RNA and 35 cycles of PCR program were used. QIAxcel electropherograms are available at figshare.com/s/d09b7b6e929a11e48bf206ec4bbcf141.

Sugimoto Y., Vigilante A., Darbo E., Zirra A., Militti C., D’Ambrogio A., Luscombe N.M, & Ule J. (2015). hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1. Nature, 519(7544), 491-494.

+ Open protocol

+ Expand

Quantifying Intracellular Calcium Dynamics

Check if the same lab product or an alternative is used in the 5 most similar protocols

Non-polarized and polarized T84 cells on transwells were pretreated with or without thapsigargin (10 μM, Sigma) for 1 h and incubated with GC (MOI~10) apically with or without the inhibitors for 4 h. thapsigargin is an endoplasmic reticulum Ca 2+ ATPase inhibitor that causes Ca 2+ elevation in the cytoplasm and thereby served as a positive control. Cells were incubated with the fluorescent calcium indicator Fluo-4 (100 μM, Life Technologies) for 1 h, and xz images were acquired in the presence of the membrane dye CellMask (5 mg/ml, Life Technology) using Leica TCS SP5X confocal microscope (Leica Microsystems). The MFI of Fluo-4 in the cytoplasmic region in individual cells was measured using the NIH ImageJ software. Twenty randomly selected cells from each of three independent experiments were quantified.

Yu Q., Wang L., Stein D.C., & Song W. (2021). Gonococcal invasion into epithelial cells depends on both cell polarity and ezrin.

+ Open protocol

+ Expand

Endoplasmic Reticulum Stress in Adipocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

HepG2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM low glucose, 1g/L glucose) (Wisent, Toronto, ON, Canada) supplemented with 10% Fetal Bovine Serum (FBS) and 1% Antibiotic/Antimicotic (Wisent). HepG2 cells were seeded in wells 24-48hrs prior to treatments, and treated when cells reached 70% confluence. Medium was removed and replaced with treatments consisting of thapsigargin (25nM, 50nM, 100nM, 200nM) or tunicamycin (2.5ug/ml, 5ug/ml, 10ug/ml, 20ug/ml) (Sigma Aldrich, St. Louis, MO, USA) diluted in medium. 3T3L1 and C3H/10T1/2 adipocytes were maintained in DMEM (4.5g/L glucose) supplemented with fetal bovine serum and differentiated for 10 days following incubation with a differentiation protocol previously described (11 (link)). Differentiation was initiated two days post-confluency in DMEM containing 10% Fetal Bovine Serum in presence of a differentiation cocktail (insulin, Dexamethasone, IBMX) for two days. In the two following days, dexamethasone and IBMX were removed. In the following days, the cells were maintained in DMEM, 10% FBS until full differentiation was achieved (day 8) (11 (link)). Following differentiation, medium was removed and replaced with treatments consisting of thapsigargin (25nM, 50nM, 100nM) or tunicamycin (2.5ug/ml, 5ug/ml, 10ug/ml) (Sigma Aldrich, St. Louis, MO, USA) diluted in medium.

Abdullahi A., Stanojcic M., Parousis A., Patsouris D, & Jeschke M.G. (2017). Modeling Acute ER stress in vivo and in vitro. Shock (Augusta, Ga.), 47(4), 506-513.

+ Open protocol

+ Expand

Stress Granule Formation Dynamics

Check if the same lab product or an alternative is used in the 5 most similar protocols

For ER stress, cells were treated with 1 μM thapsigargin (Tg; Sigma, T9033; 1 mM stock in DMSO was used) for 1.5 hrs. To confirm SG-specific effects, 2 μg/ml of cycloheximide (CHX; Sigma, C7698), 10 μg/ml of emetine (EMT; Sigma, E2375) or 10 μg/ml of puromycin (PUR; Sigma, P8833) was co-treated with thapsigargin. DMSO (1:1000)-treated cells were used as a control for the ER experiment. For heat-shock (HS) stress, water (1:1000)-treated cells were incubated at 43 °C/5% CO₂ for 45 min. For arsenite (AS) stress, cells were treated with 0.5 mM NaAsO₂ (Sigma, S7400; 0.5 M stock in water was used) for 1 hr. For both HS and AS experiments, water (1:1000)-treated cells incubated at 37 °C/5% CO₂ were used as a control.

Namkoong S., Ho A., Woo Y.M., Kwak H, & Lee J.H. (2018). Systematic Characterization of Stress-Induced RNA Granulation.. Molecular cell, 70(1), 175-187.e8.

+ Open protocol

+ Expand

Thapsigargin and Hypoxia in PC12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Confluent PC12 cells were incubated with 0.32 × 10⁻⁵ M thapsigargin (Sigma-Aldrich) for 1 h, 4 h or 24 h at either 37 °C or 31 °C in a standard incubator, in order to establish a positive control for UPR activation in the cell line. To identify suitable working concentrations, a survival MTT (Methylthiazol Tetrazolium Bromid, Sigma-Aldrich) assay was performed with 10 different thapsigargin concentrations (0.02 × 10⁻⁵ M to 10.24 × 10⁻⁵ M). A control sample of untreated PC12 cells with the lowest corresponding DMSO concentration (0.031%) was incubated for 24 h at 37 °C. One biological sample for each treatment parameter was generated.
Three biological samples of PC12 cells (grown to confluency at 37 °C) were incubated at 37 °C or 31 °C for 1 h, 3 h, 6 h or 12 h in a hypoxic incubation chamber with 0.3% O₂, controlled with nitrogen.
Three biological control samples were incubated for 12 h in a standard incubator (5% CO₂) at 37 °C. Biological triplicates were generated for each treatment parameter (time/temperature). At the end of incubation time, cells quickly proceeded to RNA isolation.

Poone G.K., Hasseldam H., Munkholm N., Rasmussen R.S., Grønberg N.V, & Johansen F.F. (2015). The Hypothermic Influence on CHOP and Ero1-α in an Endoplasmic Reticulum Stress Model of Cerebral Ischemia. Brain Sciences, 5(2), 178-187.

+ Open protocol

+ Expand

Monitoring XBP1 splicing under ER stress

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Calcium Imaging of SOCE and ER Store Depletion

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded into black-walled 96-well plates (CellBIND; Corning, Corning, NY, USA, CLS3340) at a density of 20 × 10³ cells per well, and Ca²⁺ imaging was performed 24 h later using FLIPR^TETRA (Molecular Devices, San Jose, CA, USA). Cyclopiazonic acid (CPA; Sigma-Aldrich, St. Louis, MI, USA, C153P)-induced SOCE was performed as previously described [55 (link)]. For thapsigargin (Sigma-Aldrich, St. Louis, MI, USA, T9033)-induced ER store depletion, 1 µM of thapsigargin in either nominal or 1.8 mM CaCl₂ PSS was added after 10 s and assessed for an additional 600 s. Changes in fluorescence intensity relative to baseline fluorescence over time were expressed as cytosolic Ca²⁺ changes (ΔF/F₀).

Robitaille M., Chan S.M., Peters A.A., Dai L., So C.L., Bong A.H., Sadras F., Roberts-Thomson S.J, & Monteith G.R. (2022). ORAI1-Regulated Gene Expression in Breast Cancer Cells: Roles for STIM1 Binding, Calcium Influx and Transcription Factor Translocation. International Journal of Molecular Sciences, 23(11), 5867.

+ Open protocol

+ Expand

Quantifying Intracellular Calcium Dynamics

Check if the same lab product or an alternative is used in the 5 most similar protocols

The intracellular Ca²⁺ concentration [Ca²⁺]_i was measured using the ratiometric fluorescent Ca²⁺ dye Fura2-AM (Thermo Fisher Scientific) and the FlexStation3 (Molecular Devices) as previously described^{41 ,42}. The Ca²⁺ content of the ER was measured by applying thapsigargin (2 μM; Sigma-Aldrich) in the presence of 3 mM EGTA (a cell-impermeable Ca²⁺ chelator, added 30 seconds prior to thapsigargin treatment) and quantifying the rise in F340/F380. Normalized Ca²⁺-rise (R) in the cytosol of cultured chondrocytes was calculated as (R-R₀)/R₀. The basal F340/380 signals were calibrated to obtain basal cytosolic [Ca²⁺] as described before⁴³. The total Ca²⁺-loading capacity of the endoplasmic reticulum (ER) in the presence of exogenously added Mg/ATP (5 mM) and mitochondrial inhibitors (10 mM NaN₃) was analyzed in plasma membrane-permeabilised chondrocytes using unidirectional ⁴⁵Ca²⁺ uptake (0.3 MBq/ml) experiments performed as described before⁴⁴, allowing direct access to ER Ca²⁺ stores. The ER ⁴⁵Ca²⁺ loading capacity was normalized to protein content.

Stegen S., Laperre K., Eelen G., Rinaldi G., Fraisl P., Torrekens S., Van Looveren R., Loopmans S., Bultynck G., Vinckier S., Meersman F., Maxwell P.H., Rai J., Weis M., Eyre D.R., Ghesquière B., Fendt S.M., Carmeliet P, & Carmeliet G. (2019). HIF-1α metabolically controls: collagen synthesis and modification in chondrocytes. Nature, 565(7740), 511-515.

+ Open protocol

+ Expand

Preparation and Incubation of Kidney Slices

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Kidney slices were prepared as previously described [14 (link), 33 (link)]. Before the harvest of both kidneys, mice were perfused at 17 ml/min using HBBS (110 mM NaCl, 3 mM KCl, 1.2 mM MgSO₄, 1.8 mM CaCl₂, 4 mM Na acetate, 1 mM Na citrate, 6 mM D-glucose, 6 mM L-alanine, 1 mM NaH₂PO₄, 3 mM Na₂HPO₄, 25 mM NaHCO₃) or Ca²⁺-free-HBBS, under deep anesthesia. The kidneys were sliced (< 0.5 mm) using a microslicer (Natume Seisakusho Co., Ltd, Tokyo, Japan) and ice-cold HBBS. Following recovery in HBBS at room temperature for 20 min, the slices were transferred to the incubation chambers containing 3 mM K⁺ or 10 mM K⁺ with/without 5 mM EGTA. For thapsigargin and SEA0400 analysis, slices were pre-incubated in 100-μM thapsigargin (Sigma-Aldrich, St. Louis, MO, USA) and 50-μM SEA0400 for 30 min at room temperature before transferred to the incubation chambers. After incubation at 28°C for 30 min, slices were snap frozen in liquid nitrogen and processed for immunoblotting. During the experiments, all solutions were continuously bubbled with 95% O₂ and 5% CO₂. (S3 Fig)

http://dx.doi.org/10.17504/protocols.io.baf9ibr6

Shoda W., Nomura N., Ando F., Tagashira H., Iwamoto T., Ohta A., Isobe K., Mori T., Susa K., Sohara E., Rai T, & Uchida S. (2020). Sodium–calcium exchanger 1 is the key molecule for urinary potassium excretion against acute hyperkalemia. PLoS ONE, 15(6), e0235360.

+ Open protocol

+ Expand

ER Stress and DNA Damage Induction

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cells were treated with different drugs to induce ER stress and to test the activation of the pathway of interest. To induce ER stress, the cells were treated with thapsigargin at 2 μM for 2 h, and MG132 (both products of Sigma-Aldrich, St. Louis, MO, USA) at 10 μM for 16 h. For flow cytometry analysis after ER stress induction, thapsigargin was used at 1 μM for 5 h and MG132 at 20 μM for 5 h. In addition to ER stress, DNA damage was induced in the cells with the application of etoposide.

Hernández-Suárez B., Gillespie D.A., Obmińska-Mrukowicz B, & Pawlak A. (2023). An initial characterisation of the Unfolded Protein Response pathway in haematopoietic canine cancer cell lines – a necessary step for the future development of new therapies in dogs with neoplasia. Journal of Veterinary Research, 67(3), 447-458.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!