The strains used for antimicrobial activity determination, E. coli ATCC 25922, E. coli ATCC 078, E. coli UB 1005, Salmonella Typhimurium (S. Typhimurium) C 7731, S. Typhimurium ATCC 14028, P. aeruginosa ATCC 27853, Staphylococcus aureus (S. aureus) ATCC 29213, S. aureus ATCC 25923, Staphylococcus epidermidis (S. epidermidis) ATCC 12228, and Streptococcus faecalis (S. faecalis) ATCC 29212, were all preserved by the Institute of Animal Nutrition, Northeast Agricultural University. The vector pPICZaA was purchased from Liuhe Huada Gene Technology Co., Ltd. (Beijing, China). Restriction endonucleases were obtained from Thermo Fisher Co., Ltd. (Waltham, USA), and SUMO protease was purchased from Gene Copoeia (Guangzhou, China). A plasmid extraction kit was obtained from Genstar (Beijing, China). The Ni–NTA Sefinose (TM) resin kit was purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The purity of other chemical reagents used was of analytical grade.
Plasmid extraction kit
Manufactured by GenStar
Sourced in China
The Plasmid Extraction Kit is a laboratory tool designed to isolate and purify plasmid DNA from bacterial cultures. It provides a reliable and efficient method for extracting plasmid DNA for further applications.
Automatically generated - may contain errors
2 protocols using plasmid extraction kit
1
Antimicrobial Activity Determination Protocols
2
Engineering E. coli MG1655 with CRISPR-Cas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCas9 and pGL3-U6-SgRNA-PGK-Puromycin Plasmid (Youbio, Hunan, China) was extracted from E. coli DH5α by Plasmid extraction kit (GenStar, Beijing, China). The pCas9 Plasmid was transfected into E. coli MG1655 (Tiangen, Beijing, China) to acquire a E. coli MG1655 (pCas9). The transformed E. coli MG1655 was screened using Kanamycin (50 mg/L) that was added to the LB medium. Genomic DNA was extracted from E. coli MG1655 by Bacterial genome extraction kit (GenStar, Beijing, China).
The MG-HR-S and MG-HR-X were ampli ed by PCR using the genomic DNA as a template. The primers were designed with prime primer 5.0. The primers were synthesized by the Beijing Invitrogen Biotechnology Company. The primers TCTGGTGTGTCTGGCGAAGT and TGCTAATTCGTGGAGCTTATGCCAGCG TTGAGGCCATG were used to amplify MG-HR-S. The primers TAAGCTCCACGAATTAGCATCAGCAGATGCGAGATCTTAT and CTATGGC AAGGAAAACAGGGT were used to amplify MG-HR-X. MG-HR-S was connected to MG-HR-X by PCR to acquire a MG-HR.
The MGP-sgRNA and pGL3 were ampli ed by PCR using the pGL3-U6-SgRNA-PGK-Puromycin Plasmid as a template.
The MG-HR-S and MG-HR-X were ampli ed by PCR using the genomic DNA as a template. The primers were designed with prime primer 5.0. The primers were synthesized by the Beijing Invitrogen Biotechnology Company. The primers TCTGGTGTGTCTGGCGAAGT and TGCTAATTCGTGGAGCTTATGCCAGCG TTGAGGCCATG were used to amplify MG-HR-S. The primers TAAGCTCCACGAATTAGCATCAGCAGATGCGAGATCTTAT and CTATGGC AAGGAAAACAGGGT were used to amplify MG-HR-X. MG-HR-S was connected to MG-HR-X by PCR to acquire a MG-HR.
The MGP-sgRNA and pGL3 were ampli ed by PCR using the pGL3-U6-SgRNA-PGK-Puromycin Plasmid as a template.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!