Iscove modified dulbecco media (imdm)

Biocoll (14 mL, Biochrom) was overlayed by a mixture of DPBS (5 mL, Lonza) and buffy coat (30 mL), derived from healthy male donors. After centrifugation (20 min, 550×g) the PBMC layer was washed with DPBS (5 min, 160×g). Biocoll and wash steps were repeated twice. Pellet was resuspended in IMDM (25 mL, Thermo Scientific) overlayed on Percoll (46%, GE Healthcare Life Sciences) in IMDM and centrifuged (20 min, 550×g). From PBMC layer monocytes were selected according to the protocol of the human Monocyte Isolation Kit II (MiltenyiBiotec). Monocyte experiments were performed in complete medium composed of 10% FBS and gentamicin sulfate in IMDM (Thermo Fisher Scientific).

All cell lines were acquired from DSMZ (Braunschweig, Germany). HL60 and K562 were cultured in RPMI-1640 medium (Life Technologies, Darmstadt, Germany) with 10% fetal bovine serum (FBS) (Biochrom, Berlin, Germany) and 1% PenStrep (PAN-Biotech, Aidenbach, Germany). Kasumi-1 cells were cultured with RPMI-1640 medium, 1% PenStrep and 20% FBS.
Human bone marrow CD34+ cells, containing HSPCs, were purchased from Lonza (Cologne, Germany) and cultured using IMDM (GE Healthcare Life Sciences, Pasching, Austria) complemented with 20% FBS 2% glutamine, 100 U PenStrep, 20 ng/ml FLT3-l, 20 ng/ml GM-CSF, hIL-3 10 ng/ml, hIL-6 20 ng/ml, hSCF 20 ng/ml, hTPO 20 ng/ml all from Peprotech (Hamburg, Germany).
PDX were described before [30 (link)]. Briefly, cells were isolated from NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ (NSG) mice bone marrow and then cultured in StemPro-34 SFM Medium (StemCell Technologies, Grenoble, France) supplemented with 1% PenStrep, 1% L-Glutamine, 2% FBS and 10 ng/ml SCF, TPO and IL-3.
The pMSCV-IRES-GFP ZBTB7A WT, R402C, and A175fs were described before [1 (link)]. The pMSCV-RUNX1-RUNX1T1tr-IRES-tdTomato was described before [31 (link)]. pSpCas9(BB)-2A-GFP (px458) is available from Addgene (Plasmid #48138) and gRNA sequences targeting ZBTB7A (GACTCGAGGTACTCCTTGGCG or GCCGCCGCTGCCAGCTTCCCG) were cloned as described before [32 (link)].

Burkitt lymphoma cell lines Ramos and Raji were obtained from ATCC, diffuse large B-cell lymphoma cell line Oci-Ly1 and chronic lymphocytic leukemia cell line MEC1 were obtained from DSMZ. Chronic lymphocytic cell line HG3 was kindly provided by the lab of Dr. Rosenquist (Uppsala, Sweden). Ramos, Raji, Oci-Ly1 and HG3 cells were cultured in RPMI 1640 (HyClone, GE Healthcare), while MEC1 cell line was cultured in IMDM (HyClone, GE Healthcare) medium. Media were supplemented with 10% heat-inactivated fetal bovine serum (FBS; Biosera) and penicillin/streptomycin (Sigma-Aldrich). Cell cultures were maintained at 37 °C in 5% CO₂ atmosphere.

The HEK293A cell line was provided by Thermo Fisher Scientific (MA, USA) and maintained in DMEM (Nissui Pharmaceutical, Tokyo, Japan) supplemented with 10% (v/v) foetal bovine serum (Thermo Fisher Scientific). The Hap1 cell line was provided by Horizon Genomics (Vienna, Austria) and maintained in IMDM (GE Healthcare, IL, USA) supplemented with 10% (v/v) foetal bovine serum. Cells were cultured at 37°C in a humidified incubator continuously flushed with a mixture of 5% CO₂ and 95% air. Cells were authenticated with a morphology check by microscopy and using growth curve analysis with an Operetta CLS instrument (PerkinElmer, MA, USA). All cell lines were confirmed to be mycoplasma-free.
Tandem ER stress response element-2 (ERSE2), unfolded protein response element (UPRE), amino acid response element (AARE) and heat-shock element (HSE) were assembled by Golden Gate cloning with the Multiplex CRISPR/Cas9 Assembly System Kit (Addgene Kit # 1000000055, MA, USA). 10X ERSE2-10X UPRE-5X AARE (EUA), 25X ERSE2, 25X UPRE, 25X AARE and 5X HSE-EGFP reporter vectors were constructed based on the lenti-Cas9-blast vector (gift from Feng Zhang [Addgene plasmid # 52962]). The DNA sequence of each construct was verified on an ABI 3130 DNA sequencer (Thermo Fisher Scientific). HEK293A and Hap1 cells stably expressing the reporter gene were sorted with an S3e Cell Sorter (Bio-Rad, CA, USA).

HL-60 and HL-60Res cells were cultured in Iscove’s modified Dulbecco’s medium(IMDM)(GE healthcare Biosciences, Uppsala, Sweden), supplemented with 20% fetal bovine serum (GE healthcare Biosciences). U937 cells were cultured in RPMI-1640 medium (GE healthcare Biosciences) supplemented with 10% fetal bovine serum in a humidified atmosphere of 95% air and 5% CO₂ at 37 ºC. Cell viability was assessed by trypan blue exclusion as previously described [12 (link)].