Sgrna ms2 cloning backbone

The PAM sequences used for dCas9 recognition, which were localized at a position within 200 bp upstream of the TSS, were retrieved by E-crisp (http://www.e-crisp.org/E-CRISP/) in silico module. Oligonucleotides containing guide sequences (Table S3) to recognize the PAM were ligated into sgRNA (MS2) cloning backbone (Cat No.: 61424, Addgene) to achieve constructs that could be used for promoter activation. TransFectin Lipid Reagent (BioRad) was used for plasmid transfection. Upregulation of miR-371/372/373 expression following transfection denoted endogenous induction.

For the CRISPR/dCas9 Synergistic Activation Mediator (SAM) system, lentiviral plasmids were purchased from Addgene for the dCas9-VP64-GFP (#61422-LVC) and MS2-P65-HSF1_Hygro (#61426-LVC) constructs (titers ≥ 8 × 10⁶ TU/ml). For the Per1 sgRNA, we cloned and inserted an antisense guide sequence corresponding to the CRE element in the Per1 promoter (AGAGGGAGGTGACGTCAAAG) into the Addgene sgRNA(MS2) cloning backbone (#61427). The control sgRNA was identical, except that no guide sequence was cloned into the plasmid. Lentiviruses for both the Per1 sgRNA (titer: 6.8 × 10⁷ IFU/ml) and control sgRNA (3.5 × 10⁷ IFU/ml) were produced by the USC School of Pharmacy Lentiviral Laboratory.
For the pLVX-V5Per1 overexpression construct, we amplified full-length wildtype Per1 from the Addgene pCMV-Sport2-mPer1 plasmid (#16203) and cloned the product into a modified pLVX-EF1α-IRES-mCherry backbone (Takara, #631987). The IRES and mCherry elements were removed and were replaced with a V5 tag, allowing for an N-terminal fusion to PER1 (plasmid MW206). For the empty vector (EV) control, the PER1 coding sequence was not present but all other elements remained (Plasmid MW93). Lentiviruses for the pLVX-v5Per1 (titer: 1.3 × 10⁸ IFU/ml) and pLVX-EV (titer: 1.5 × 10⁸ IFU/ml) were produced by the USC School of Pharmacy Lentiviral Laboratory. All lentiviral constructs were expressed under the EF1α promoter.

The potential sequence segments allowing dCas9 recognition within ~250 bp upstream of the NUMB transcription start site were predicted by the E-crisp (http://www.e-crisp.org/E-CRISP/assessed date: 20 September 2017) module [44 (link)]. Eight oligonucleotides containing sgRNAs that recognize these sequences were ligated into the sgRNA (MS2) cloning backbone (Addgene) to generate SAM constructs for promoter activation (Figure S3). The dCas9-SAM#6 construct was validated as the most potent construct for NUMB induction in pilot tests (Table S4).