Gateway expression system

Manufactured by Thermo Fisher Scientific

The Gateway expression system is a recombination-based cloning technology that enables the transfer of DNA sequences between multiple vectors. It allows for the efficient and reliable creation of expression clones, facilitating the study of gene function and protein expression.

Automatically generated - may contain errors

Lab products found in correlation

Lr clonase 2, by Thermo Fisher Scientific (4 mentions) Plenti6 v5 dest, by Thermo Fisher Scientific (3 mentions) Pad cmv v5 dest, by Thermo Fisher Scientific (2 mentions) Sub1 cdna, by OriGene (2 mentions) Blasticidin, by Santa Cruz Biotechnology (2 mentions) Blasticidin, by Merck Group (1 mentions) Superdex 200, by GE Healthcare (1 mentions) Ni nta agarose column, by Qiagen (1 mentions) Constant cell disruption system, by Constant Systems (1 mentions) Hitrap heparin hp column, by GE Healthcare (1 mentions) Hitrap, by Cytiva (1 mentions)

Spelling variants of this product

Gateway system (383 citations) ViraPower HiPerform T-Rex Gateway Expression System (5 citations) ViraPower Gateway expression system (2 citations) ViraPower™ II Lentiviral Gateway™ Expression System (2 citations)

8 protocols using gateway expression system

Adenoviral Transduction of PAICS in Lung Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

PAICS cDNA (Origene, MD; Cat# RC223925) was cloned into Gateway expression system (Life Technologies CA). To generate adenoviral construct, PCR8-PAICS (flag tagged) was recombined with pAD/CMV/V5-Dest™ (Life Technologies, CA) respectively using LR Clonase II (Life Technologies, CA) [71 (link)]. Adenoviruses were generated by the University of Michigan Vector Core. Benign lung epithelial cells (BEAS2-B) were infected with adenoviruses expressing PA1CS or lacZ for transient over-expression.

Goswami M.T., Chen G., Chakravarthi B.V., Pathi S.S., Anand S.K., Carskadon S.L., Giordano T.J., Chinnaiyan A.M., Thomas D.G., Palanisamy N., Beer D.G, & Varambally S. (2015). Role and regulation of coordinately expressed de novo purine biosynthetic enzymes PPAT and PAICS in lung cancer. Oncotarget, 6(27), 23445-23461.

+ Open protocol

+ Expand

Lentiviral Overexpression of SUB1

Check if the same lab product or an alternative is used in the 5 most similar protocols

SUB1 cDNA (Origene, MD; Cat# RC204999; Myc-DDK tagged) was cloned into Gateway expression system (Life Technologies CA). To generate lentiviral constructs, PCR8-SUB1 (Myc-DDK tagged) was recombined with pLenti6/V5-Dest™ (Life Technologies, NY) using LR Clonase II (Life Technologies, NY). Lentiviruses were generated by the University of Michigan Vector Core. Benign immortalized prostate cells (RWPE) were infected with lentiviruses expressing SUB1 or lacZ and stable clones were selected with 3.5 μg/ml blasticidin (Santa Cruz Biotechnology, Inc., Dallas, Texas).

Chakravarthi B.V., Goswami M.T., Pathi S.S., Robinson A.D., Cieślik M., Chandrashekar D.S., Agarwal S., Siddiqui J., Daignault S., Carskadon S.L., Jing X., Chinnaiyan A.M., Kunju L.P., Palanisamy N, & Varambally S. (2016). MicroRNA-101 regulated transcriptional modulator SUB1 plays a role in prostate cancer. Oncogene, 35(49), 6330-6340.

+ Open protocol

+ Expand

Lentiviral Overexpression of SUB1

Check if the same lab product or an alternative is used in the 5 most similar protocols

SUB1 cDNA (Origene Technologies, Rockville, MD, USA; cat. no. RC204999; Myc-DDK tagged) was cloned into Gateway expression system (Life Technologies). To generate lentiviral constructs, PCR8-SUB1 (Myc-DDK tagged) was recombined with pLenti6/V5-Dest (Life Technologies) using LR Clonase II (Life Technologies). Lentiviruses were generated by the University of Michigan Vector Core. Benign immortalized prostate cells (RWPE) were infected with lentiviruses expressing SUB1 or lacZ, and stable clones were selected with 3.5 μg/ml blasticidin (Santa Cruz Biotechnology Inc., Dallas, TX, USA).

+ Open protocol

+ Expand

Overexpression of KLK4-KLKP1 in Prostate Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

KLK4-KLKP1 cDNA was PCR amplified using a forward primer with DDK tag and a reverse primer from KLK4-KLKP1 template and was cloned into the Gateway expression system (Life Technologies). To generate lentiviral and adenoviral constructs, PCR8-KLK4-KLKP1 (DDK tagged) was recombined with pLenti6/V5-Dest (Life Technologies) or pAD/CMV/V5-Dest (Life Technologies), respectively, using LR Clonase II (Life Technologies). For transient overexpression in HEK-293, RWPE-1, and PrEC cells, adenoviruses carrying KLK4-KLKP1, EZH2, or lacZ were added to the culture media after cells reached 50%-70% confluency. At the same time, cells were treated with or without bortezomib (100 nM in ethanol, 10 μl, Cayman Chemical, catalog #10008822). After incubation for 48 hours at 370°C, cells were harvested by scraping. For stable overexpression, RWPE-1 cells were infected with lentiviruses expressing KLK4-KLKP1 or lacZ, and stable clones were selected with blasticidin (3.5 μg/ml, Sigma-Aldrich, St Louis, MO). Lenti- and adenoviruses were generated by the University of Michigan Vector Core (Ann Arbor, MI).

Chakravarthi B.V., Dedigama-Arachchige P., Carskadon S., Sundaram S.K., Li J., Wu K.H., Chandrashekar D.S., Peabody J.O., Stricker H., Hwang C., Chitale D.A., Williamson S.R., Gupta N.S., Navone N.M., Rogers C., Menon M., Varambally S, & Palanisamy N. (2019). Pseudogene Associated Recurrent Gene Fusion in Prostate Cancer. Neoplasia (New York, N.Y.), 21(10), 989-1002.

+ Open protocol

+ Expand

Cloning and Expressing Membrane Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

H37Rv genomic chromosomes were donated by Professor Zongde Zhang (Beijing Tuberculosis & Thoracic Tumor Research Institute, China). E. coli DH5α cells were used for plasmid construction, and the E. coli BL21 (DE3) (Novagen, Darmstadt, Germany) strain was used for protein expression. For membrane protein expression, the Gateway expression system^{26 (link),27} (Invitrogen, Camarillo, American) was employed according the manufacturer’s instructions.

Li H., Liu L., Zhang W.J., Zhang X., Zheng J., Li L., Zhu X., Yang Q., Zhang M., Liu H., Chen X, & Jin Q. (2019). Analysis of the Antigenic Properties of Membrane Proteins of Mycobacterium tuberculosis. Scientific Reports, 9, 3042.

+ Open protocol

+ Expand

Lentiviral ERp44 Transduction of Cardiomyocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral ERp44 cDNA (Catalog No.: OHS‐1770‐9381769; Open Biosystems, Huntsville, AL) was constructed using the Gateway expression system (Invitrogen, Carlsbad, CA) and transfected into mouse neonatal and adult cardiomyocytes (MNCs), as described previously.^{12 (link)} Briefly, neonatal cardiomyocytes were incubated with lentiviral supernatant overnight, and fresh medium was replaced after 24 hours, followed by 2 μg/mL of puromycin‐containing media for 72 hours to select the puromycin‐resistant homogenous population of transduced cells.

Wang D., Abbasi C., El‐Rass S., Li J.Y., Dawood F., Naito K., Sharma P., Bousette N., Singh S., Backx P.H., Cox B., Wen X., Liu P.P, & Gramolini A.O. (2014). Endoplasmic Reticulum Resident Protein 44 (ERp44) Deficiency in Mice and Zebrafish Leads to Cardiac Developmental and Functional Defects. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 3(5), e001018.

+ Open protocol

+ Expand

Expression and Purification of Recombinant Inositol Kinases

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant human IP6K2 and the human IPMK and PPIP5K2 kinase domain were prepared as previously described.^{41 (link),47 ,48 (link)} Human IP3KA kinase domain (residues 173–461, UniProtKB code P23677) was cloned into the pDest-566 vector by the Gateway expression system (Invitrogen).^{48 (link)} Genscript synthesized the codon-optimized cDNAs for expression in Escherichia coli of 6xHis-MBP tagged human IP6K1 (N-terminally tagged with 6×-His followed by MBP) and IP6K3 (N-terminally tagged with 6×-His followed by Sumo). The procedures for IP6K1, IP6K3, IPMK, and IP3KA expression and purification were identical to those used for IP6K2 except that the MBP tag was cut by TEV protease in IPMK and IP3KA. The cells were disrupted using a constant cell disruption system (Constant Systems) under 20 kpsi. Recombinant IP6Ks were purified with a Ni-NTA agarose column (Qiagen) followed by a HiTrap heparin HP column (GE Healthcare). As a final step, a Superdex 200 gel filtration column (GE Healthcare) was used with a running buffer of 150 mM NaCl and 20 mM Tris-HCl, pH 7.5. The purity of these proteins was estimated to be >80% as judged by SDS-PAGE. The purified proteins were stored in aliquots at −80 °C.

Zhou Y., Mukherjee S., Huang D., Chakraborty M., Gu C., Zong G., Stashko M.A., Pearce K.H., Shears S.B., Chakraborty A., Wang H, & Wang X. (2022). Development of Novel IP6K Inhibitors for the Treatment of Obesity and Obesity-Induced Metabolic Dysfunctions. Journal of medicinal chemistry, 65(9), 6869-6887.

+ Open protocol

+ Expand

Dicistronic Constructs for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The dicistronic construct pRF was a generous gift from Professor Anne Willis, University of Cambridge. pRWT1F, pRCCND1F, and pRWT1-RevF were constructed by inserting the mouse Wt1 5′UTR, human Ccnd1 5′UTR, or mouse Wt1 5′UTR in reverse orientation into EcoRI and NcoI sites of the pRF vector. Mouse Wt1 5′UTR and human Ccnd1 5′UTR sequence were amplified by PCR. The primers amplifying the whole transcript of pRF binding to the 5′ end of Renilla and 3′ end of Firefly ORF: pRF-F: GCCACCATGACTTCGAAAGTTTATGA; pRF-R: TTACACGGCGATCTTTCCGC. FLAG-tagged HnRNPA1 and mutant plasmids were generated by inserting the coding sequence and a mutant sequence of mouse HnRNPA1, respectively, into NheI and BamHI sites of the pDC316-mCMV-ZsGreen-C-FLAG vector. Adenoviruses containing WT1 coding sequence, HnRNPA1, or the mutant sequence were generated using the Gateway Expression System (Invitrogen). The primers used for constructing the plasmids are as follows:

Chen M., Dong F., Chen M., Shen Z., Wu H., Cen C., Cui X., Bao S, & Gao F. (2021). PRMT5 regulates ovarian follicle development by facilitating Wt1 translation. eLife, 10, e68930.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!