Mirna purification kit

Total RNA (including miRNA) was extracted from breast cancer samples or collected cells using the miRNA purification kit (CWBIO). For examination of mRNA expression, the RNA was reversely transcribed into cDNA as instructions of the manufacturer, followed by an examination of RT‐qPCR using SYBR Mix (CWBIO). For the determination of miRNA, the cDNA synthesis reaction was performed with a One‐Step miRNA cDNA Synthesis Kit (including primers for miRNA and U6, HAI‐gene Bio Inc). GAPDH and U6 were indicated as internal controls for mRNA and miRNA, respectively. All samples were examined in triplicate for each specific gene. The primer sequences for PCR are as follows: forward primers 5′‐ TGGATTCGACTTAGACTTGACCT ‐3′ and reverse primer 5′‐ TGCTTTGAATCCAAAAACCTTACT ‐3′ for PTEN, forward primers 5′‐GCCCAATACGACCAAATCC‐3′ and reverse primer 5′‐AGTCCTTCCACGATACCAAAGT‐3′ for GAPDH.

TRIzol kit (Invitrogen, Carlsbad, CA, USA) and miRNA Purification kit (CWBIO, Beijing, China) were used to isolate RNA and miRNA, respectively, from clinical specimens and cells. The extracted RNA was used for synthesizing cDNA using FastKing RT reagents (Tiangen, Beijing, China).
PrimeScript miRNA reverse transcription reagents (TaKaRa, Dalian, China) were adopted for reverse transcription of miRNA. qRT-PCR reaction was performed on a qRT-PCR system (Bio-Rad, Hercules, CA, USA) after mixing of SYBR Green Premix (TaKaRa), primers (shown in Table 1) and cDNA/miRNA. The relative expression of circRNA/miRNA/mRNA was analyzed by the 2^−∆∆Ct method with the normalization to U6 or glyceraldehyde 3-phosphate dehydrogenase (GAPDH).Table 1

Primers sequences used for qRT-PCR

Name	Sequence (5ʹ-3ʹ)
hsa_circ_0003074
Forward	CAGAATTGGTGGGAGTGTGC
Reverse	GGCCATGATCAACAATATCACTGC
DHTKD1
Forward	CCTCCAGAGCTGATGTTCCG
Reverse	AGAGTAATCGCCGTCTTGGC
KPNA4
Forward	GAATGTGGAGGGCTGGAGAA
Reverse	GCCTCTGGAACAAGGCTAGG
miR-516b-5p
Forward	GCCGAGATCTGGAGGTAAGAAG
Reverse	CTCAACTGGTGTCGTGGAGT
GAPDH
Forward	GGAGCGAGATCCCTCCAAAAT
Reverse	GGCTGTTGTCATACTTCTCATGG
U6
Forward	CTCGCTTCGGCAGCACA
Reverse	AACGCTTCACGAATTTGCGT

DHTKD1: dehydrogenase E1 and transketolase domain containing 1

Total RNA and miRNA from HK-2 cells and tissue were isolated using a miRNA Purification Kit (CWBio, China). The miRNA was reverse-transcribed into cDNA with a miRNA cDNA Synthesis Kit (CWBio, China). The mRNA was reverse-transcribed into cDNA using a HiFiScript gDNA Removal cDNA Synthesis Kit (CWBio, China). The mRNA and miRNA levels were tested by qRT-PCR using UltraSYBR Mixture (Low ROX) (CWBio, China). The expression of TGF-β, α-SMA, and 3-phosphoinositide-dependent protein kinase 1 (PDPK1) mRNA was normalized to that of the GAPDH gene, and U6 was used as the internal reference for mir-129-5p. The primer sequences used for qRT-PCR are shown in Table 1. The fold change was calculated using the 2^−∆∆Ct method, and the means from three independent experiments were used.

Total RNA was isolated from cells of the wild-type group (WT), RIP2-knockdown group (shRIP2), APEC-challenge group (APEC), and RIP2-knockdown with APEC challenge group (shRIP2+APEC) using an miRNA Purification Kit (CWBIO, Beijing, China) according to the manufacturer’s instructions. A total of 3 µL RNA was used as input for miRNA library preparation by using the KC-Digital^TM small RNA Library Prep Kit for Illumina^® (Catalog No. DR08602, Wuhan Seqhealth Co., Ltd., Wuhan, China) following the manufacturer’s instructions. The kit eliminated duplication bias in the PCR and sequencing steps by using a unique molecular identifier (UMI) of 8 random bases to label the preamplified small RNA molecules. The eluted cDNA library was separated using 6% PAGE gel. Approximately 160 bp bands were isolated, purified, and quantified using Qubit 3.0, and finally sequenced on a Hiseq X-10 sequencer (Illumina) with a PE150 model.

For quantification of relevant mRNA expression, total mRNA was extracted from osteoblasts and osteoclasts using the Ultrapure RNA Kit (CWBIO Inc., Beijing, China). Then, 1 μg of the total mRNA was reverse transcribed into cDNA using the HiFiScript cDNA synthesis kit (CWBIO Inc., Beijing, China) in a 20 μl reverse transcription system. Quantitative real-time PCR (qRT-PCR) analysis was performed on an ABI7500 Real-Time PCR system using the SYBR Green qPCR Master Mix kit (Yeasen, Shanghai, China). We normalized the relative gene expression to β-actin or GAPDH using the 2^-ΔΔCt method.
For quantification of relevant miRNA expression, total mRNA was isolated using the miRNA Purification Kit (CWBIO Inc., Beijing, China) and TRIzol reagent. Next, 1 µg of mRNA as template RNA was reverse transcribed into cDNA using the miRNA cDNA Synthesis Kit (Vazyme, Nanjing, China) in compliance with the manufacturer’s instructions. Quantitative RT-PCRs were performed using the miRNA Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) in a 20 μl reaction system. The conditions of the 40 cycles were 95 °C for 10 s and 60 °C for 30 s. Small nucleolar RNA (snRNA) U6 was used as an internal control. All primer sequences are listed in Supplementary Table S1.