RNA was isolated with TRIzol reagent (Solarbio, Beijing, China) followed by reverse transcription using the MicroRNA Reverse Transcription Kit (TIANGEN, Beijing, China). RT-qPCR was carried out on the ABI 7500 Fast Real-Time PCR Platform (Applied Biosystems) with the PCR Master Mix (TIANGEN, Beijing, China). The conditions of qPCR were initiated at 94 ℃ for 5 min, followed by 39 cycles of 94 ℃ for 10 s and 58 ℃ for 30 s. U6 RNA expression was detected as the control. The primers were designed as miR-26a f, 5’-GACTGTTCAAGTAATCCAGGATA; miR-26a r, 5’-GTGCAGGGTCCGAGGTATTC; U6 RNA f, 5’-CTCGCTTCGGCAGCACA; U6 RNA r, 5’-AAACGCTTCACGAATTTG CGT. The relative expression of miR-26a was qualified with the 2−ΔΔCT formula.
Abi 7500 fast real time pcr platform
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7500 Fast Real-Time PCR platform is a laboratory instrument designed for nucleic acid amplification and detection. It utilizes real-time PCR technology to enable rapid and accurate quantification of target DNA or RNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Pcr master mix, by Tiangen Biotech (1 mentions)
Microrna reverse transcription kit, by Tiangen Biotech (1 mentions)
Trizol reagent, by Solarbio (1 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
One step primescript mirna cdna synthesis kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Tiangen dna blood mini kit, by Tiangen Biotech (1 mentions)
Genomic dna extraction kit ver 5, by Takara Bio (1 mentions)
Abi prism 7700 sds software, by Thermo Fisher Scientific (1 mentions)
Rneasy, by Qiagen (1 mentions)
Tianamp genomic dna kit, by Tiangen Biotech (1 mentions)
Engen lba cas12a cpf1, by New England Biolabs (1 mentions)
Easypure genomic dna kit, by Transgene (1 mentions)
Nebuffer r2, by New England Biolabs (1 mentions)
Sds 1, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assays for human, by Thermo Fisher Scientific (1 mentions)
11 protocols using abi 7500 fast real time pcr platform
1
Quantitative Analysis of miR-26a Expression
2
Quantifying MMP2 and MMP9 mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was performed to measure the relative expression of MMP2 and MMP9 mRNA. Total RNA was extracted from brain tissues using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and RT was performed to synthesize cDNA. RNA was converted into cDNA using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. MMP2 and MMP9 mRNA expression was detected on an ABI 7500 fast real time PCR platform (Applied Biosystems; Thermo Fisher Scientific, Inc.) using a SYBR Premix Ex Taq™ kit (Takara Bio, Inc., Otsu, Japan) and the following primers: MMP2, forward 5′-CTGGGCCACGCCATCGCTGC-3 and reverse 5′-GCTTGCGGGGAAAGAAGTTG-3′; MMP9, forward 5′-GGCAGCCCCTGCTCCTGGTG-3′ and reverse 5′-CCTTTAGTGTCTCGCTGTCC-3′; GAPDH, forward 5′-CTCCTCCTGGCCTCGCTGT-3′ and reverse 5′-GCTGTCACCTTCACCGTTCC-3′. Temperature protocols were as follows: 95°C for 4 min followed by 40 cycles of 95°C for 30 sec, 60°C for 35 sec and 72°C for 20 sec and a final extension step at 65°C for 6 min. The relative mRNA expression level was analyzed using the 2−∆∆Cq method with GAPDH as the internal reference gene (19 (link)). Each reaction was run in triplicate.
3
Profiling RNA and miRNA in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation from BCa cell lines and clinical tissue specimens was done with the RNAiso Plus Reagent (Takara). Generation of cDNA from RNA was done using the One Step PrimeScript miRNA cDNA Synthesis Kit and the PrimeScript RT Reagent Kit (Takara). Comparison of transcript and miRNA contents was assessed via running qPCR on the ABI 7500 fast real-time PCR Platform (Applied Biosystems) with the SYBR Premix Ex Taq (Takara), with U6 small nuclear RNA and GAPDH mRNA serving as the normalization standards of miRNA and mRNA, respectively. The 2−ΔΔCt approach was adopted to explore relative expression. All primers used are listed: miR-5581-3p 5′-TTCCATGCCTCCTAGAAGTTCC-3′; FTO F 5′-ACTTGGCTCCCTTATCTGACC-3′; FTO R 5′-TGTGCAGTGTGAGAAAGGCTT-3′; SMAD3 F 5′-TGGACGCAGGTTCTCCAAAC-3′; SMAD3 R 5′- CCGGCTCGCAGTAGGTAAC-3′; GAPDH F: 5′- AAGGTGAAGGTCGGAGTCA-3′; GAPDH R: 5′-GGAAGATGGTGATGGGATTT-3′; U6 F 5′-TGCGGGTGCTCGCTTCGGCAGC-3′.
4
Genomic DNA Extraction and SNP Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from peripheral blood leukocytes using the TIANGEN DNA Blood Mini Kit (TIANGEN Biotech CO., LTD, Beijing, China) and SNP genotyping was performed by TaqMan assay. The probes, primers and the related information about assay conditions, are available upon request. SNP allele-specific probes were labeled with the fluorescent dyes VIC and FAM by using the TaqMan SNP Genotyping Assays on the ABI 7500 Fast Real-Time PCR platform (Applied Biosystems, Life Technologies Corporation, Foster City, CA, USA). The genotyping rates of these SNPs were all above 90%. For quality control, approximately 10% of samples were randomly selected for repeated confirmation. Some of these samples were also confirmed by DNA sequencing analysis. The concordance rate of these repeated samples reached 100%, indicating that the genotyping method and results were reliable.
5
PTEN/PI3K/AKT Pathway SNP Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the peripheral blood (5 mL) by Genomic DNA Extraction Kit Ver.5.0 (Takara Biotechnology (Dalian) Co.LTD, Dalian, China). Three SNPs (MAF≥0.05) located in the 5′ and 3′ UTRs of the PTEN/PI3K/AKT pathway genes was selected and genotyped using predesigned TaqMan SNP Genotyping Assays on the ABI 7500 Fast Real-Time PCR platform (Applied Biosystems, Life Technologies Corporation, Foster City, CA, USA). The detailed information of the selected 3 SNPs in PTEN/PI3K/AKT pathway were outlined in Supplementary Table 1 . The information about assay conditions, primers, and probes is available upon request. The reaction mixture of 10 mL contained 25 ng genomic DNA, 3.5 mL of TaqMan Genotyping Master Mix, 0.25 mL of the primers and probes mix and 6.25 mL of double distilled water. The amplification was performed under the following conditions: 50°C for 2 min, 95°C for 10 min followed by 45 cycles of 95°C for 15 sec, 60°C for 60 sec. The genotyping rates of these SNPs were all above 95%. For quality control, 5 negative controls were included in each plate and 10% of the samples were randomly selected for repeated genotyping for confirmation; and the results were 100% concordant. All samples were run in duplicates with call rates of >95%, and all output spectra were visually inspected.
6
Real-time RT-PCR Validation of miRNA Profiles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time RT-PCR was performed on all samples to validate miRNA profiling results; we used an ABI 7500 Fast Real-time PCR platform (Applied Biosystems, a division of Thermo Fisher Scientific Inc., Waltham, MA, USA) to this end. We selected eight miRNAs identified as of interest by miRNA microarray profiling (upregulated: miR-21, miR-27a, miR-146a, miR-200a, and miR-196a; downregulated: miR-217, miR-20a, and miR-96). Reverse transcription was performed using species-specific primers (Applied Biosystems) (Table 1 ). Data were analyzed with the aid of ABI Prism 7700 SDS software (Applied Biosystems).
7
Quantification of PHLPP and PHLPP2 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted by column purification kit (Qiagen RNeasy), and then retro-transcribed into first-strand cDNA using the High Capacity cDNA Reverse Transcription Kit following the manufacturer’s protocol (Thermo Fisher Scientific, CAT#4368814). qRT-PCR was performed using SYBR™ Select Master Mix (LiCfe Technologies, cat# 4472908) on an ABI 7500 Fast Real-Time PCR platform (Applied Biosystems). Relative mRNA levels of each gene showed were normalized to the expression of the housekeeping gene GAPDH. Real-time PCR Primer as follows: PHLPP (Forward, CCTCATCCGCTTCTATGCAGG; Reverse, GCATCTTGCCTTTACGGAC); PHLPP2 (Forward, ATGGAGCAGACACTACCACTG; Reverse, GCAAAGGACGAGATGTAAGTCA); GAPDH (GGAGCGAGATCCCTCCAAAAT; Reverse, GGCTGTTGTCATACTTCTCATGG). Each sample was amplified in triplicate, and data were analyzed by relative quantitation using the ΔΔCt method and normalization to GAPDH.
8
Genotyping of STAT3 Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was directly extracted from EDTA-treated peripheral blood using TIANamp Genomic DNA Kit [Tiangen Biotech (Beijing) Co., Ltd., Beijing, China] according to manufacturer’s instruction. STAT3 rs1053004 and rs1053005 polymorphisms were genotyped by TaqMan MGB high throughput RT-PCR method on the ABI 7500 fast real-time PCR platform (Applied Biosystems, ABI Technologies, USA). The results were analyzed on 7500 Fast System V1.4.0 SDS software. For quality control, the genotyping was repeated once with concordance rate of 100% in the samples included in the study.
9
Isothermal Amplification Using Recombinase Polymerase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinase polymerase–based amplification kit for isothermal amplification was purchased from Msunflowers Biotech Co., Ltd. (Beijing, China). The 100-bp DNA marker and the EasyPure® Genomic DNA Kit for genomic DNA extraction and purification were obtained from TransGene Biotech Co., Ltd. (Beijing, China). EnGen® Lba Cas12a (Cpf1) and NEBuffer r2.1 were purchased from New England Biolabs (Beijing, China). The ABI 7500 FAST real-time PCR platform (Applied Biosystems, USA) was used as the fluorescence reader. An imaging system (Gel Doc XR C, Bio-Rad, USA) was used for gel image taken.
10
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was reverse transcribed into cDNA with a High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems ® , Monza, Italy). Semi-quantitative real-time PCR was performed using Taqman Gene Expression Assays for human ACTB (Hs99999903_m1), IL-1b (Hs01555410_m1), NLRP3 (Hs00366465_m1), CASP1 (Hs00354836_m1), SOD2 (Hs00167309_m1) and HemeOH (Hs01110250_m1) genes (Applied Biosystems ® Thermo Fisher, Monza, Italy) with the ABI 7500 Fast Real-Time PCR platform (Applied Biosystems ® Thermo Fisher, Monza, Italy). The PCR amplification cycle was "standard mode": after denaturation at 96 C for 10 min, 40 PCR cycles were performed composed by 15 s at 95 C and a final melting step for 1 min at 60 C. All samples were analysed in triplicate using the SDS 1.4 software (Applied Biosystems ® Thermo Fisher, Monza, Italy). Results were normalized to ACTB expression and then to untreated cells according to 2 ÀDDCt method [27] .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!