Advantage rt for pcr kit

Total RNA was extracted from hMSC cells after 14 days of treatment with Ca citrate and K citrate by using the RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany). Total mRNA was reverse transcribed by the Advantage RT-for-PCR Kit (Roche Diagnostics, Monza, Italy). The expression of “tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide” (YWHAZ) (NM_003406), “secreted protein acidic and cysteine rich” (SPARC or osteonectin) (NM_003118.4) and bone sialoprotein (IBSP) (NM_004967.4) were evaluated by qRT-PCR using the Light Cycler instrumentation (Roche Diagnostics). Probes and specific primers were selected using a web-based assay design software (ProbeFinder Software, online available at the Assay Design Center: https://lifescience.roche.com/en_it/brands/universal-probe-library.html#assay-design-center). The sequences of primers selected for the analysis were: YWHAZ-forward 5′-ccgttacttggctgaggttg-3′, YWHAZ-reverse 5′-tgcttgttgtgactgatcgac-3′; SPARC-forward 5′-acccgctttttcgagacc-3′, SPARC-reverse 5′-caagatccttgtcgatatccttct-3′; IBSP-forward 5′-cgaagaaaatggagatgacagtt-3′; IBSP-reverse 5′-cttcattgttttctccttcatttg-3′. The results were expressed as the ratio between gene of interest and YWHAZ, used as reference genes, according to the 2−ΔΔCT method [26 (link)].

Total RNA was extracted from pulverized and homogenized LV tissue using TRIzol reagent (Invitrogen, 15596‐026) and reverse transcribed into cDNA (synthesized from 2 μg of RNA from each group) with an Advantage RT‐for‐PCR Kit (No. 04896866001; Roche, Germany) according to the manufacturer's instructions. Quantitative RT‐PCR analysis was performed with LightCycler 480 SYBR Green 1 Master Mix (No. 04707516001; Roche, Germany) according to the manufacturer's instructions. All primer information was provided in Table 1 and the results were normalized against glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) expression.

Total RNA was isolated from in vitro cardiomyocytes 24 h after treatment and liquid nitrogen snap‐frozen heart tissue, respectively, using TRIzol reagent (Invitrogen) and treated for 45 min at 37°C with RQ1 DNase (Promega). RNA was reverse transcribed using oligo (dT) primers with the Advantage RT‐for‐PCR kit (Roche), according to the manufacturer's instructions. The Real‐time PCR was done in an ABI Prism 7000 Sequence Detection System (Applied Biosystems) using SYBR Green PCR Master mix (Applied Biosystems) and the thermocycler conditions recommended by the manufacturer. GAPDH was used as reference genes to normalize for differences in the amount of total RNA in each sample. Melting curve analysis showed a single sharp peak with the expected Tm for all samples. mRNA relative quantities were obtained using the 2^−△△Ct method. Primer pairs for amplification of indicated genes are: Anp‐mouse: 5’‐ACCTGCTAGACCAC CTGGAG‐3’ (forward), 5’‐CCTTGGCTG TTATCTTCGGTACCGG‐3’ (reverse). Bnp‐mouse: 5’‐GAGGTCACTCCTATCC TCTGG‐3’ (forward), 5’‐GCCATTTCC TCCGACTTTTCTC‐3’ (reverse). β‐Mhc–mouse: 5’‐CCGAGTCCCAGG TCAA CAA‐3’ (forward), 5’‐CTTCACGGGCACCCTTGGA‐3’ (reverse). Collagen I‐mouse: 5’‐AGGCTTCAGTGGTTTGGATG‐3’ (forward), 5’‐CACCAACAGCAC CATCGTTA‐3’ (reverse). Collagen III‐mouse: 5’‐CCCAACCCAGAGATCCC ATT‐3’ (forward).