Pure powder of APR was purchased from Zhejiang Hisun Pharmaceutical Co., Ltd., Taizhou, China. MacConkey medium, eosin-methylene blue medium, Mueller-Hinton (MH) broth, and MH agar were supplied form Qingdao Hope Bio-Technology Co., Ltd., Qingdao, China. Premix Taq™ Version 2.0 plus dye and DL1000 DNA Marker were obtained from Takara Biotechnology Co., Dalian, China. All primers used in the study were synthesized by the Sangon Biotech Co., Ltd., Shanghai, China.
Premix taq version 2.0 plus dye
Manufactured by Takara Bio
Sourced in China
Premix Taq Version 2.0 plus dye is a pre-mixed solution containing Taq DNA polymerase, buffer, dNTPs, and a tracking dye. It is designed for convenient and efficient DNA amplification in polymerase chain reaction (PCR) applications.
Automatically generated - may contain errors
Lab products found in correlation
Macconkey medium, by Hopebio (1 mentions)
Eosin methylene blue medium, by Hopebio (1 mentions)
Dl1000 dna marker, by Takara Bio (1 mentions)
Bamhi, by New England Biolabs (1 mentions)
Ecori, by New England Biolabs (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
Tianprep mini plasmid kit, by Tiangen Biotech (1 mentions)
Primer premier 6, by Premier Biosoft (1 mentions)
S1000, by Bio-Rad (1 mentions)
3 protocols using premix taq version 2.0 plus dye
1
Antibiotic Resistance Profiling Protocol
2
Cloning and Sequencing of Target Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from healthy human blood samples using the RNAsimple Total RNA Kit (DP419, TIANGEN), and reverse transcription was performed using First‐Strand cDNA Synthesis SuperMix (AT301, TransGen Biotech) to synthesize cDNA. The target fragment was amplified with DNA polymerase (TaKaRa Premix Taq Version 2.0 plus dye) using the following primers (designed by Primer 5.0 software): 5′‐ATGCAGAGGTCGCCTCTGG‐3′ and 5′‐CAACCAAAGAAGCAGCCACC‐3′. The amplification products were cloned into the polyclonal site of the pEGFP‐C1 vector using the restriction endonucleases BamHI and EcoRI (New England Biolabs). The wild‐type plasmid was then extracted using the TIANprep Mini Plasmid Kit (DP103, TIANGEN) and sent to Zhengzhou Sunya Biotechnology Co., Ltd. for Sanger sequencing verification.
3
SCAR Primer Design for DNA Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on the sequenced RAPD amplicons, the specific SCAR primers (Table 1 ) Pc-SFP (specific forward primer) and Pc-SRP (specific reverse primer) were designed using Primer Premier 6 software (Premier Biosoft International, USA). A 20 μL reaction system was developed to simplify the detection system. The system contained 10 μL of Premix Taq Version 2.0 plus dye (Takara Co., China), 1.0 μL of forward primer (10 mmol/L), 1.0 μL of reverse primer (10 mmol/L), and 100 ng of genomic DNA. Amplifications were conducted in a DNA thermocycler (Bio-Rad S1000) with the following conditions: 94°C for 5 min, 35 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s with a final extension at 72°C for 10 min.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!