Rotor gene software

Real-time PCR (RT-PCR) primers were designed and supplied by AusDiagnostics Pty Ltd. Three million µm² of PTEC were extracted by LCM from biopsies and total RNA was isolated from cells with the Absolutely RNA Nanoprep Kit (Stratagene) according to the manufacturer's instructions. Reverse transcription was performed using random hexamers (Invitrogen, Grand Island, NY, USA) and Superscript III Reverse Transcriptase (Invitrogen). RT-PCR reactions were performed using RT² SYBR Green qPCR master mix (QIAGEN). GAPDH was used for normalization of cDNA input, and RT-PCR reactions were performed using a Rotor-Gene Q thermal cycler (QIAGEN) according to the manufacturer's instructions: initial denaturation at 95°C for 10 min, followed by 45–50 cycles at 95°C for 15 sec and at 60°C for 60 sec. Data analysis was performed using Rotorgene software (QIAGEN) and the delta delta Ct (ΔΔCt) method.

Quantity of bacterial 16S rRNA in each density fraction was measured by quantitative polymerase chain reaction (RT-qPCR) [36 (link)] in a two-step assay using reverse transcribed RNA (cDNA) as template. Amplification reactions were performed in qPCR triplicates according to a previously published method [31 (link)]. Afterwards, RNA concentrations were calculated by means of correlation to an internal standard curve generated from serial dilutions of a calibrator pool consisting of equal amounts of genomic DNA isolated from Faecalibacterium prausnitzii A2-165, Escherichia coli DH5-α, Lactobacillus plantarum WCSF1 and Clostridium perfringens CH05 using the Rotor-Gene Software (version 1.6; Qiagen, Valencia, CA, USA). RNA concentrations in each gradient fraction were averaged across the qPCR triplicates and expressed as percentage RNA concentration relative to the maximum quantity detected among all fractions within the gradient [32 (link)].

Total RNA was isolated from leaves of 4-week-old tomato plants. RNA extraction and cDNA synthesis were performed as described by Livne et al. (2015) (link). Quantitative reverse transcription-PCR analysis was performed using the Absolute Blue qPCR SYBR Green ROX Mix (AB-4162/B) kit (Thermo Fisher Scientific). Reactions were performed using a Rotor-Gene 6000 cycler (Corbett Research). A standard curve was obtained for each gene using dilutions of a cDNA sample. Each gene was quantified using Corbett Research Rotor-Gene software. At least three independent technical repeats were performed for each cDNA sample. The relative expression of each sample was calculated by dividing the expression level of the analyzed gene by that of TUBULIN. Gene-to-TUBULIN ratios were then averaged. All primer sequences are presented in Supplementary Table S1 at JXB online.

mtDNA copy number was determined as described, by calculating the ratio of mtDNA to nuclear DNA (ACTB) per cell in relation to standard curves of known concentrations, ranging from 10⁻¹ ng/μL to 10⁻⁸ ng/μL [42 (link)]. Quantitative PCR was performed on a Rotor Gene RG-3000 (Corbett Research, Mortlake, Australia), with RotorGene software (v6.0) used for data acquisition and analysis. Standard curves were used with a correlation coefficient of R² > 0.9 and an efficiency coefficient of R > 0.95. Mitochondrial DNA copy number per cell was calculated as follows:

After PBMC isolation cells were preserved and stored in lysis buffer (Macherey Nagl RNA Isolation Kit, Düren, Germany). RNA was purified by using the Nucleo Spin RNA II kit (Macherey Nagel). Extracted total RNA was transcribed into cDNA using oligo-dT, hexanucleotide random primers and Super Script II Reverse transcriptase. PCR analysis was performed using 20 ng cDNA, Sybr-green Mix (Sensi Mix Plus SYBR Genxpress, Wien, Austria), and specific primers (10 pMol each). Analyses were carried out in a Corbett Rotor Gene 6.000 using Rotor Gene Software (Corbett Research, Cambridge, United Kingdom). The primers used for quantification were human Robo4 (5- GGATCACAGGAAGTGGAGGA; rev: 5-AACCCATTTGTTTGGCATGAG), Clec14 (5-AGAA GCTGGGAGAGACACCA, rev: 5-TGAGGAGTGGC AGAGGAAGT) and endothelial cell-specific chemotaxis regulator (ECSCR) (5-CAGCTGCCCTGTGACTACAA; rev: 5-CAGCAGCTGTCCATACAGGA). The TEM expression levels were normalized to the respective GAPDH expression levels (5-CATGACAACTTTGGTATCGTG, rev: 5- GTGTCGCTGTTGAAGTCAGA).