The proportion of transfected Th2 cells was determined by FACS analysis following transfection with 50 nM BLOCK-iT fluorescent oligo (Invitrogen) and lipofectamine RNAiMax (Invitrogen) as described above. The proportion of FITC-labeled cells was determined 1–48 h post-transfection in cells at various stages throughout the differentiation protocol (from naïve CD4+ T cells to 96 h in culture) exposed to i) BLOCK-iT fluorescent oligo + lipofectamine, ii) BLOCK-iT fluorescent oligo without lipofectamine and iii) lipofectamine only. Cells transfected with 40 nM BLOCK-iT fluorescent oligo were imaged 1 and 3 h post-transfection and co-stained with LysoTracker Red DND-99 (Invitrogen) for live cell imaging in a Leica DMI6000 B inverted fluorescence microscope (Leica Microsystems, Germany) equipped with a Leica DFC365 FX camera (Leica) and recorded using the LAS X software (Leica). Images were compiled in ImageJ (v.1.53k).
Block it fluorescent oligo
Manufactured by Thermo Fisher Scientific
Sourced in United States, Italy
The BLOCK-iT Fluorescent Oligo is a laboratory equipment product designed for the detection and visualization of oligonucleotides. It provides a fluorescent label that can be attached to oligonucleotides, enabling their tracking and analysis in various experimental settings.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (20 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (13 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (3 mentions)
Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (2 mentions)
Stealth rnai, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (2 mentions)
Pcdna3, by Thermo Fisher Scientific (2 mentions)
Lecithin, by Thermo Fisher Scientific (2 mentions)
Cholesterol, by Merck Group (2 mentions)
Epics xl mcl flow cytometer, by Beckman Coulter (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Penicillin, by Thermo Fisher Scientific (2 mentions)
Streptomycin, by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Smartpool sirna, by Horizon Discovery (1 mentions)
On targetplus smartpool, by Thermo Fisher Scientific (1 mentions)
Transit x2 dynamic delivery system, by Mirus Bio (1 mentions)
Mouse neural stem cell nucleofector kit, by Lonza (1 mentions)
53 protocols using block it fluorescent oligo
1
Quantifying Transfection Efficiency in Th2 Cells
2
Efficient siRNA and miRNA Knockdown in CHO Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHO GPIb-IX cells at 90% confluence were transfected in T-25 flasks with 240 pmol siRNA oligos or 240 pmol Block IT fluorescent oligo (Life Technologies) to determine siRNA transfection efficiency or alternatively 18 μg pCMV-miGPIBA-eGFP or 18 μg pCMV-eGFP using Lipofectamine2000 (Life Technologies) according to the manufacturer’s instructions. Transfection efficiencies for siRNA and miRNA mediated knockdown was assessed using Block IT fluorescent oligos (Life Technologies) and pCMV-eGFP plasmid, respectively. As previously shown [24 (link)–26 (link)], insertion of miRNA sequences targeted to a transgene in 5’ or 3’ of the ORF of a reporter gene resulted in a nearly complete loss of eGFP expression (Figure A in S2 File ).
Cells were stained 48h post transfection using the anti-GPIbα monoclonal antibody (moAb) 6B4 and a goat anti-mouse-PE secondary Ab (Jackson Immunoresearch, West Grove, PA) [27 (link)]. After fixation, cells were analyzed on an EPICS XL-MCL Flow Cytometer (Beckman-Coulter, Fullerton, CA). A gate was set for viable CHO GPIb-IX cells as determined by propidium iodide staining (data not shown) where 10,000 events were collected. Analysis was done using Flowing software 2.5 version (http://www.flowingsoftware.com/ ).
Cells were stained 48h post transfection using the anti-GPIbα monoclonal antibody (moAb) 6B4 and a goat anti-mouse-PE secondary Ab (Jackson Immunoresearch, West Grove, PA) [27 (link)]. After fixation, cells were analyzed on an EPICS XL-MCL Flow Cytometer (Beckman-Coulter, Fullerton, CA). A gate was set for viable CHO GPIb-IX cells as determined by propidium iodide staining (data not shown) where 10,000 events were collected. Analysis was done using Flowing software 2.5 version (
3
SiRNA-Mediated Knockdown of P2X Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For small interfering RNA (siRNA) experiments, either Sertoli cells or spermatogonia were transfected 12–24 h before experiments using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Before transfection, the culture medium was replaced with antibiotic-free medium. siRNA (Applied Biosystems/Ambion) was cotransfected with BLOCK-iT fluorescent oligo (FITC labeled; Thermo Fisher Scientific). Opti-MEM I Reduced Serum Medium (500 µl; Thermo Fisher Scientific) containing 6 µl Lipofectamine 2000, 502.5 ng siRNA (75 nM), and 1.875 µl BLOCK-iT fluorescent oligo (75 nM) was added to each culture dish. Transfected cells were identified by FITC fluorescence. We used the following Silencer Select Pre-designed siRNA constructs to down-regulate receptor protein expression: P2X4 RNAi1, #s71184; P2X4 RNAi2, #s71185; P2X2 RNAi1, #s106892; P2X2 RNAi2, #s106893; and P2X7 RNAi, #s71189. As negative control, we used Silencer Select negative control #1 and #2 siRNA.
4
Transient Knockdown of ALDH1A1 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following the manufacturer's instructions, transient transfection was carried out by using Lipofectamine 2000 (Invitrogen) with ALDH1A1‐specific siRNA (insert CATGATTCAGTGAGTGGCAAGAAAT) and scramble sequence siRNA from Invitrogen. BLOCK‐iT Fluorescent Oligo was used to examine transfection efficiency (Invitrogen). Seventy‐two hours after transfections, cells were harvested and used for further experiments.
5
Transfection of miRNA, anti-miRNA, and siRNA
6
Silencer CREB and GSK-3α gene knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Silencer CREB siRNA and GSK-3α siRNAs were purchased from Thermo scientific or Invitrogen; CREB siRNA (109994, Invitrogen), GSK-3α siRNA-1 (L-003009-00-0005, ON-TARGETplus SMARTpool, ThermoScientific), and GSK-3α siRNA-2 (145366, Invitrogen). BLOCK-it Fluorescent Oligo (Invitrogen) was used as a control. Each siRNA was transfected using Lipofectamine RNAiMAX (Invitrogen). Also, cells were infected with lentiviral shScrambled or shRNAs targeting CREB or GSK-3α with 8 μg/ml polybrene and the infected cells were selected with puromycin. The sequences of shRNAs are listed in the S1 Table (available online). For CREB overexpression, H1437 and A549 cells were transfected with plasmid DNA of pCMV-empty or pCMV-CREB (Clontech Laboratories, Inc.) using Lipofectamine 2000 (Invitrogen).
7
Gene Knockdown Using siRNA Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For siRNA knockdown, cells were transfected with Silencer Select (Life Technologies) and Stealth RNAi (Invitrogen) targeted to ATXN1L, ATXN1, or TRIM25. Targeted siRNA information can be found in Additional file 15 : Table S8B. Each siRNA was tested independently prior to pooled siRNA experiments (data not shown). Control transfections were performed with Stealth RNAi™ siRNA Negative Control, Med GC (12935300, Thermo Fisher Scientific), or BLOCK-iT Fluorescent Oligo (13750062, Invitrogen). FLAG-tagged ATXN1L (#33242) [47 (link)] and FLAG-tagged TRIM25 (#12449) [48 (link)] constructs were purchased from Addgene. Transfections were performed at ~ 70% confluency using TransIT-X2® Dynamic Delivery System (Mirus Bio LLC) or nucleofection (Mouse Neural Stem Cell Nucleofector Kit: VPG-1004, Lonza, Basel, Switzerland) according to the manufacturer’s protocol. Cells were harvested 24–72 h post-transfection for experiments. Stable transfection of FLAG-tagged CIC-S in CICKO cells was performed as previously described [30 ].
8
Gab2 Gene Silencing in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were plated in a 35-mm dish for 24 h before transfection into the complete medium. Transfection was performed with Lipofectamine 2000 (Invitrogen), according to the manufacturer's instructions. Stealth small interfering RNA (siRNA) against human Gab2 (5′-GTGAGAACGATGAGAAATA-3′) and a scrambled siRNA were synthesized by Invitrogen. BLOCK-iT Fluorescent Oligo was used to examine the transfection efficiency (Invitrogen). Cells were harvested after 72 h and used for further experiments. Stable transfectants were selected by using 600 µg/ml neomycin.
9
Hypoxia-Induced HIF-1α Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
U87MG cells were cultured to 60–70% confluence in 6-well plates or 24-well plates and transfected with 30 nM siRNA against HIF-1α (Invitrogen) or BLOCK-iT Fluorescent Oligo (Invitrogen) as a negative control using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instruction. Forty-eight hours after transfection, the medium was changed and cells were incubated in hypoxia for 2 or 24 h.
10
L-plastin Gene Silencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
L-plastin siRNA (Santa Cruz Biotechnology) was used to knock down L-plastin gene expression. A fluorescein-labeled, double-stranded RNA duplex (BLOCK-iT™ Fluorescent Oligo; Invitrogen, Melville, NY, USA) was designed as a control. The siRNA molecules were diluted in Opti-MEM® I Medium without serum (Gibco) and mixed gently. Next, Lipofectamine™ 2000 (Invitrogen) was diluted in Opti-MEM I Medium without serum, mixed gently and incubated for 5 min at room temperature. The diluted siRNA molecules and diluted Lipofectamine 2000 were then combined. The mixtures were incubated for 20 min at room temperature to allow for complex formation to occur. The siRNA molecule-Lipofectamine 2000 complexes were added to each well containing cells and medium, and mixed gently by rocking the plate back and forth. The cells were incubated at 37°C in a CO2 incubator for 6 h. Next, the growth medium was replaced after 6 h, and the cells were harvested 24 h after transfection. Western blotting analysis using the L-plastin antibody was performed to assess the degree of L-plastin gene expression knockdown.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!