Log In Sign up
The largest database of trusted experimental protocols

Miniopticon thermal cycler

Manufactured by Bio-Rad
Visit Supplier
Sourced in United States

The MiniOpticon thermal cycler is a compact and efficient instrument designed for basic PCR applications. It features a simple, user-friendly interface and can accommodate a variety of sample volumes and plate formats. The MiniOpticon provides consistent temperature control and reliable performance, making it a practical choice for routine laboratory tasks.

Automatically generated - may contain errors

Lab products found in correlation

Iscript cdna synthesis kit, by Bio-Rad (4 mentions) Ssofast evagreen supermix, by Bio-Rad (4 mentions) Ribogreen reagent, by Thermo Fisher Scientific (3 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Tri reagent, by Merck Group (1 mentions) Novoscript plus all in one 1st strand cdna synthesis supermix gdna purge, by Novoprotein (1 mentions) Novostart sybr qpcr supermix plus kit, by Novoprotein (1 mentions) Quantstudio 6 flex, by Thermo Fisher Scientific (1 mentions) Tissue rna kit, by Omega Bio-Tek (1 mentions) Primer sequences, by Thermo Fisher Scientific (1 mentions) Tripure isolation reagent, by Roche (1 mentions) Sybr premix ex taq 2, by Takara Bio (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Tripure reagent, by Roche (1 mentions) Iq sybr green supermix system, by Bio-Rad (1 mentions) Rneasy mini kit, by Qiagen (1 mentions)

Spelling variants of this product

Thermal cycler (533 citations) MiniOpticon (92 citations) Bio-Rad cyclers (3 citations)

8 protocols using miniopticon thermal cycler

1

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was obtained using TriReagent (Sigma Aldrich, St. Louis MO) following the manufacturer’s instructions. RNA concentration was determined fluorometrically using the RiboGreen reagent (Invitrogen, Carlsbad CA).
Total mRNA was retrotranscribed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Transcript levels were determined by real-time PCR using the SsoFast EvaGreen Supermix and the MiniOpticon Thermal Cycler (Bio-Rad). Ten seconds of denaturation at 95 °C was followed by 30 seconds of annealing/extension at 60 °C and repeated for 40 cycles. Every qPCR was validated by analyzing the respective melting curve. Only one peak was detectable, indicating the presence of just one amplicon.
Gene expression was normalized to both GAPDH and TATA-binding protein (TBP) expression and calculated using the 2−ΔΔCt method.
Primers sequences used (forward and reverse) are indicated in Supplementary Table S1 (see supplementary information).
Aversa Z., Pin F., Lucia S., Penna F., Verzaro R., Fazi M., Colasante G., Tirone A., Fanelli F.R., Ramaccini C., Costelli P, & Muscaritoli M. (2016). Autophagy is induced in the skeletal muscle of cachectic cancer patients. Scientific Reports, 6, 30340.
+ Open protocol
+ Expand
2

Extraction and Analysis of CLIC mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from tissues using the Tissue RNA kit (OMEGA Bio Tek, USA) according to the manufacturer's instructions. The purity and concentration of RNA were determined according to 260/280 nm absorbance ratios using a NanoDrop 2000 spectrophotometer (ND-2000, Thermo Fisher Scientific, Waltham, MA, USA). One μg of total RNA was reverse transcribed using Novoscript® Plus All-in-one 1st Strand cDNA Synthesis Super Mix (gDNA Purge) (Novoprotein, China), qPCR analysis was performed using Novostart® SYBR qPCR Super Mix Plus Kit (Novoprotein, China) with a Quantstudio 6 Flex (Applied Biosystems, USA). For real-time PCR, 1 μl of the cDNA was used for mRNA amplification using KAPA SYBR FAST PCR Universal Kit (KapaBio systems) in a Mini-Opticon Thermal Cycler (BIORAD). Primers used for CLIC2, CLIC3 and CLIC4 with the specific forward and reverse primers designed in the 3' untranslated or other specific regions with Primer 5.0 software based on the assembled transcriptome sequences (Table 2).
Liu G., Zhao Y., Chen H., Jia J., Cheng X., Wang F., Ji Q., Thorne R.F., Chen S, & Liu X. (2020). Analysis of Differentially Expressed Genes in a Chinese Cohort of Esophageal Squamous Cell Carcinoma. Journal of Cancer, 11(13), 3783-3793.
+ Open protocol
+ Expand
3

Quantifying mRNA Levels by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was obtained using TriPure isolation reagent (Roche Applied Science, Indianapolis, IN) following the manufacturer's instructions. RNA concentration was determined fluorometrically using RiboGreen reagent (Invitrogen, Carlsbad, CA). RNA integrity was checked by electrophoresis on 1.2% agarose gel containing 0.02 mol/L morpholinopropanesulfonic acid and 18% formaldehyde. Total mRNA was retrotranscribed using an iScript cDNA synthesis kit (Bio-Rad Laboratories). Transcript levels were determined by real-time PCR using the SsoFast EvaGreen supermix and the MiniOpticon thermal cycler (Bio-Rad Laboratories), normalizing the expression for TBP. Primer sequences (Invitrogen, Carlsbad, CA) were as follows:
VDR FW CCTCATAAAGTTCCAGGTGGGG
VDR RV GGATAGGCGGTCCTGAATGG
TBP FW TGTCCAGAGCACCAACAGTC
TBP RV TAACAGCAGCAAAACGCTTG
Camperi A., Pin F., Costamagna D., Penna F., Menduina M.L., Aversa Z., Zimmers T., Verzaro R., Fittipaldi R., Caretti G., Baccino F.M., Muscaritoli M, & Costelli P. (2017). Vitamin D and VDR in cancer cachexia and muscle regeneration. Oncotarget, 8(13), 21778-21793.
+ Open protocol
+ Expand
4

Cytokine Profiles in Immunized Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cytokine profiles (IL-4, IL-10, IL-12 and IFN-γ) of immunized mice were measured using quantitative PCR (qPCR). The amplification primer pairs are shown in Additional file 1. For amplification, total RNA was isolated from mouse spleens, and first-strand cDNA was synthesized as described above. All real-time PCR amplifications were carried out in a MiniOpticon thermal cycler (Bio-Rad) in a total volume of 12.5 μL, containing 1 μL of cDNA, 6.25 μL of SYBR® Premix Ex Taq™ II (Takara, China), 0.5 μM of each primer, and nuclease free water. The amplification steps included initial denaturation at 95 °C for 30s, followed by 40 cycles of amplification, each including denaturation at 95 °C for 30 s, annealing at 55.0–59.7 °C for 30 s, and extension at 72 °C for 30 s. The reactions were performed in triplicate, with negative controls. Dissociation curves were analyzed for each sample to confirm the specific amplification. The relative gene expression levels were calculated using the comparative 2-ΔΔCt method [34 (link)] and normalized with the hypoxanthine phosphoribosyl transferase (HPRT) gene.
Hu D., Song X., Xie Y., Zhong X., Wang N., Zheng Y., Gu X., Wang T., Peng X, & Yang G. (2015). Molecular insights into a tetraspanin in the hydatid tapeworm Echinococcus granulosus. Parasites & Vectors, 8, 311.
+ Open protocol
+ Expand
5

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted with Trizol reagent, following the manufacturer's protocol (Invitrogen, Carlsbad, CA, USA). Then RNA was quantified with the NanoDrop ND-1000 and the reverse transcription was performed using High Capacity cDNA Reverse Transcription Kit according to the manufacturer's recommendation (Applied Biosystem, Foster City, CA, USA). The cDNA was used for real-time PCR analysis using the SsoFast EvaGreen supermix and the MiniOpticon Thermal Cycler (Bio-Rad Laboratories) and for semi-quantitative RT-PCR using various primers (see Supplementary Table S2). Control samples were prepared without adding the RT enzyme to the reaction, and β-actin was used as control.
Gallo S., Gatti S., Sala V., Albano R., Costelli P., Casanova E., Comoglio P.M, & Crepaldi T. (2014). Agonist antibodies activating the Met receptor protect cardiomyoblasts from cobalt chloride-induced apoptosis and autophagy. Cell Death & Disease, 5(4), e1185-.
+ Open protocol
+ Expand
6

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was obtained using the TriPure reagent (Roche, USA) following manufacturer's instructions. RNA concentration was determined fluorometrically using the Ribogreen reagent (Invitrogen, USA). Total mRNA was retro-transcribed using the i-Script cDNA synthesis kit (Bio-Rad, USA). Transcript levels were determined by real-time PCR using the SsoFast Evagreen Supermix and the MiniOpticon thermal cycler (Bio-Rad, USA). Primer sequences are given in the supplemental material section.
Pin F., Busquets S., Toledo M., Camperi A., Lopez-Soriano F.J., Costelli P., Argilés J.M, & Penna F. (2015). Combination of exercise training and erythropoietin prevents cancer-induced muscle alterations. Oncotarget, 6(41), 43202-43215.
+ Open protocol
+ Expand
7

Quantifying GNMT mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primers for GAPDH (Fw: 5′-TCCACTCATGGCAAATTCAA; Rw: 5′-TTTGATGTTATGGGGTCTCG) were synthesized by Sigma-Aldrich. Primers for GNMT were obtained ready-to-use from Qiagen. GNMT mRNA was semi-quantified by real time-PCR, using the iQ SYBR Green Supermix system and a MiniOpticon thermal cycler (Bio-Rad Hercules, CA, USA) according to manufacturer’s instructions. GAPDH mRNA levels were used for normalization. Reactions were run in duplicate, and a minimum of 3 animals were used independently for each determination. Amplification specificity was confirmed by melting-curve analysis of the PCR products. The relative abundance of GNMT mRNA in each sample was calculated as 2−ΔCt. No signal was detected in non-template or non-RT controls.
Carrasco M., Rabaneda L.G., Murillo-Carretero M., Ortega-Martínez S., Martínez-Chantar M.L., Woodhoo A., Luka Z., Wagner C., Lu S.C., Mato J.M., Micó J.A, & Castro C. (2014). Glycine N-methyltransferase expression in the hippocampus and its role in neurogenesis and cognitive performance. Hippocampus, 24(7), 840-852.
+ Open protocol
+ Expand
8

RT-qPCR Analysis of Cytokine Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Jejunal mucosa was removed from intestinal tissue and total RNA was extracted using an RNeasy mini kit (Qiagen, Inc.). A total of 1 µg RNA was reverse transcribed into cDNA using the IScript™ cDNA Synthesis kit (cat no. 170-8891, Bio-Rad Laboratories, Inc.) according to the manufacturer's recommended protocol. The resulting complementary DNA was then subjected to RT-qPCR using the iQ™ SYBR ® Green Supermix (cat. no. 1708880; Bio-Rad Laboratories, Inc.) according to the manufacturer's instructions. The primers used for the RT-qPCR amplification of IL-4, IFN-γ are presented in Table I, β-actin was used as an internal control. RT-qPCR reactions were conducted using a MiniOpticon thermal cycler (Bio-Rad Laboratories, Inc.) in triplicate. The amplification protocol was a follows: 1 cycle at 98˚C for 1 min followed by 40 cycles at 98˚C for 10 sec, 55˚C for 20 sec, 72˚C for 30 sec. A standard curve was generated for the determination of the linear range and amplification efficiency. The relative cytokine gene expression compared to a house keeping gene was analyzed by using the comparative quantification cycle method (22) according to the standard curve.
Sun C.Y., Bai J., Hu T.Y., Hu T.Y., Cheng B.H., Ma L., Fan X.Q., Yang P.C., Zheng P.Y, & Liu Z.Q. (2016). CD4+ T cell responses in Balb/c mice with food allergy induced by trinitrobenzene sulfonic acid and ovalbumin. Molecular medicine reports, 13(6).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!