Real-time PCR reactions were performed using Roche Lightcycler TaqMan master mix. Each reaction consisted of 1X Roche Lightcycler TaqMan master mix (Roche Diagnostics, Indianapolis, Indiana, USA), HPV-specific primer pairs and fluorescently-tagged probes for types 6, 11, 16, and 18 in a total reaction volume of 10 ml as previously described [15 (link)]. Real-time PCR reactions that target the E1 region of HPV were performed using Roche Lightcycler Sybr Green master mix (Roche Diagnostics), and sequencing of PCR products was performed as previously described [15 (link)].
Lightcycler taqman master mix
Manufactured by Roche
Sourced in Germany, Switzerland
The LightCycler TaqMan Master mix is a reagent used for quantitative real-time PCR (qPCR) analysis. It contains all the necessary components, including a DNA polymerase, buffer, and fluorescent probes, required for the amplification and detection of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy plus mini kit, by Qiagen (3 mentions)
Lightcycler 2, by Roche (3 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (3 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Transcriptor first stand cdna synthesis kit, by Roche (2 mentions)
Lightcycler, by Roche (2 mentions)
Universal probe library, by Roche (2 mentions)
Qiaamp dna blood mini kit, by Qiagen (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Lightcycler 2.0 real time pcr system, by Roche (2 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Taqman primer, by Thermo Fisher Scientific (1 mentions)
Improm 2 reverse transcription system, by Promega (1 mentions)
Quantstudio 3 system, by Thermo Fisher Scientific (1 mentions)
Cfx connect real time pcr system, by Bio-Rad (1 mentions)
Light cycler 2.0 real time pcr, by Roche (1 mentions)
Lightcycler software, by Roche (1 mentions)
Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Phaselockgel tubes, by Eppendorf (1 mentions)
20 protocols using lightcycler taqman master mix
1
Real-time PCR for HPV detection
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 16
Total RNA was extracted with the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. 1 ug RNA was reverse transcribed to cDNA using improm-II Reverse Transcription System (Promega). The reverse transcription conditions were 25° C. for 10 min followed by 37° C. for 60 min; the reaction was terminated at 95° C. for 5 min. The cDNA products were mixed with LightCycler Taqman Master Mix (Roche, 04535286001) and Taqman primers (Invitrogen) in 96-well plate according to the manufacturer's instructions. The qPCR was run in triplicate on an ABI 7700 Real-Time PCR machine (Applied Biosystem, Inc.) with initial denaturation at 95° C. for 2 min, denaturation at 95° C. for 15 s, and annealing/extension at 60° C. for 1 min for 45 cycles. Huwe1 gene expression was calculated relative to 18S RNA, and the amount of cDNA applied was adjusted to bring the Ct value for 18S RNA to within one half-cycle.
3
ASFV Detection via Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The specimens were homogenized with mortar and pestle in the presence of sterile sand. The homogenate was centrifuged at 3 000 rpm for 10 minutes before the supernatant was filtered. Viral DNA extraction was done from the supernatant with the IndiSpin Pathogen Kit (Indical Bioscience, Germany) according to the manufacturer's instructions. The extracted DNA was stored at -20°C until further analysis. The ASFV detection was carried out by following the manufacturer's instructions of the real-time virotype ASFV PCR Kit (Indical Bioscience, Germany) which the endogenous control is included. The amplification was performed on CFX Connect Real-Time PCR System (Bio-Rad, USA). Besides that, primer-probe from King et al. (2003) as recommended by the OIE was also used to detect the ASFV (OIE, 2021a). For the King et al. (2003) probe, BHQ1 was used as quencher instead of TAMRA. The 15 uL real-time PCR mixes contained final concentration of 0.5 pmol of both sense and antisense primer, 0.5 pmol of probe and 1 X LightCycler® Taqman® Master mix (Roche, Switzerland), before 5 uL of DNA was added. The reaction was subjected to 95°C for 10 minutes for initial denaturation, followed by 45 cycles of denaturation at 95°C for 10 sec, annealing at 60°C for 35 sec and extension at 72°C for 1 sec with QuantStudio 3 System (Applied Biosystems, USA).
4
Quantitative RT-PCR Analysis of Pituitary Gene Expression
5
qRT-PCR Validation of Microarray Findings
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the accuracy of the microarray results, the same RNA samples were subjected to qRT-PCR to determine the mRNA levels of Ang, ACE, angiotensin II type-1 receptor (AT-1), prostaglandin-endoperoxide synthase 1 (COX-1), adrenoceptor beta 3 (AR-β3), interleukin 24 (IL-24) and peroxisome proliferator-activated receptor δ (Pparδ). These genes were randomly selected, and the β-actin was used as internal reference gene. The cDNA was synthesized from 200 ng of the total RNA using PrimeScript 1st strand cDNA synthesis kit (Takara, Dalian, China). qRT-PCR analysis was performed with a LightCycler (Roche Diagnostics, Mannheim, Germany) using the LightCycler TaqMan Master mix (Roche Diagnostics), with the forward and reverse primers listed in S1 Table . Thermal cycling was carried out under the following condition: 95°C for 2 min, followed by 40 cycles of 10 s at 95°C, and 30 s at 60°C. Fluorescence data were analyzed with LightCycler software (Roche Diagnostics). After the reaction, the threshold cycle (Ct) was determined using default threshold settings, and the comparative Ct method (2-ΔΔCt) was used to determine the relative abundance of each gene in control or HBMP-administrated rats.
6
Quantifying Oxidative Enzyme Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in TriReagent (Sigma) and total RNA was isolated via an acid-phenol extraction procedure using Phase Lock gel tubes (Eppendorf). RNA (2 μg) was reverse-transcribed with the First-Strand cDNA Synthesis Kit (GE Healthcare) according to the manufacturer's recommendations. Q-PCR experiments were carried out in a Light Cycler 2.0, in Light Cycler Taqman Master Mix (Roche) and with the Universal Probe Library (Roche Diagnostics). The following primers were used: LOX 5′-ggatacggcactggctactt-3′ and 5′-gacgcctggatgtagtaggg-3′, LOXL1 5′-gccagtggatcgacataacc-3′ and 5′-ccaaaacaat atactttgggttca-3′, LOXL2 5′-tgacctgctgaacctcaatg-3′ and 5′-tggcacactcgtaattcttctg-3′, LOXL4 5′-ggatacggcactg gctactt-3′ and 5′-ttgttcctgagacgctgttc-3′. The HPRT1 gene was used as a normalizer, with the 5′-tgaccttg atttattttgcatacc-3′ and 5′-cgagcaagacgttcagtcct-3′ primers.
7
Molecular Diagnosis of Plasmodium Species
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reference molecular diagnosis was performed by real-time PCR using a Light Cycler 2.0 (Roche Group, Rotkreuz, Switzerland) to identify four human Plasmodium species (with the exception of P. knowlewsi), as previously described [7 (link)]. The primers and probes used were presented in Table 2 . Briefly, DNA was extracted from 200 µL of whole blood using the QIAamp® DNA Blood Mini kit, according to the manufacturer’s recommendations (Qiagen, Hilden, Germany). Each parasite species was detected by an individual real-time PCR targeting a specific gene for each of the four human Plasmodium species using the Light Cycler® TaqMan® Master Mix (Roche Group, Switzerland). For each PCR run, two negative controls (ultra-pure water and human DNA) and one positive control (specific DNA from each species) were used.
Homemade real-time PCR tests, targeting the 18S rRNA gene, were performed to differentiate P. ovale wallikeri from P. ovale curtisi using Plasmo1_F (5′ GTTAAGGGAGTGAAGACGATCAGA 3′) and Plasmo2_R (5′ AACCCAAAGACTTTGATTTCTCATAA 3′) primers, as previously described [8 (link)].
Homemade real-time PCR tests, targeting the 18S rRNA gene, were performed to differentiate P. ovale wallikeri from P. ovale curtisi using Plasmo1_F (5′ GTTAAGGGAGTGAAGACGATCAGA 3′) and Plasmo2_R (5′ AACCCAAAGACTTTGATTTCTCATAA 3′) primers, as previously described [8 (link)].
8
RNA Isolation and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Renal tissues were homogenized, sonicated, and total RNA was isolated using Ambion kit (cat.no.12183018A, PureLink TM RNA Mini Kit, Invitrogen, Life Technologies, USA) for the biological and technical triplicates and 0.5 μg RNA was used to synthesized cDNA according to the manufacturer’s instructions (part no.4368813, High Capacity cDNA Revert Transcriptase Kit, Applied Biosystems Inc., USA). It was amplified under the following PCR conditions: 94°C for five minutes, 30 cycles of PCR (94°C for 30 sec, 56°C for 30 sec, 72°C for 30 sec) 72°C for seven minutes and then at 4°C using Master Mix (cat.no.10572-063, PCR Supermix, Invitrogen, USA). Samples were electrophoresed at 2% agarose gel. For a standard reaction in real-time PCR, cDNA in 1:10 dilution was used as a PCR template. cDNA was mixed together with 2.5 nM of each primer in a final volume of 25 μl. Real-time PCR was performed using LightCycler TaqMan Master Mix (Roche, Germany) through manufacturer’s guidelines. An endogenous ‘housekeeping’ gene, 18S rRNA was quantified and used to normalize the results. All the genes were compared with control (normal adult mice) and relative genes expressions were quantified through 2^−ΔΔCt method. The probe sequences are given in Supplemental Table 1 .
9
Quantitative Detection of Clostridium spp.
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After batch experiments, samples were centrifuged at 5,000 g for 5 min, supernatant was discarded and refilled with deionized water twice. DNA extraction was performed by automated nucleic acid extractors (Magtration System 12GC, PSS CO., Japan) with Genomic kit supplied by manufacturer. The extracted DNAs were stored at -20°C.
The QPCR analysis to determine the 16S rRNA gene copy numbers of C. cadaveris and C. sporogenes was performed using a LightCycler 480 (Roche Diagnostics, Germany). The specific primer and probe sets used in this study for targeting 16S rRNA gene copy numbers of C. cadaveris and C. sporogenes were developed, where verification of specificities was performed both in silico and in vitro (Table 1 ) [13 (link)]. The mixture of QPCR was 20 ul: 2 μl of template DNA, 1 μl each of forward primer and of reverse primer (final concentration 500 nM), 1 μl of the Taqman probe (final concentration 100 nM), 5 μl of LightCycler Taqman Master Mix (Roche Diagnostics), and 10 μl of PCR-grade water.
The QPCR analysis to determine the 16S rRNA gene copy numbers of C. cadaveris and C. sporogenes was performed using a LightCycler 480 (Roche Diagnostics, Germany). The specific primer and probe sets used in this study for targeting 16S rRNA gene copy numbers of C. cadaveris and C. sporogenes were developed, where verification of specificities was performed both in silico and in vitro (
10
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Semi-quantitative RT-PCR analyses was performed as previously described in Bustany et al. [13 (link)]. Total RNA was purified from cultured MM cell lines with the Trizol reagent (Invitrogen) according to the manufacturer’s instructions. The RNA was reverse-transcribed using the SuperScript® VILO cDNA Synthesis Kit (Invitrogen). PCR primers and Universal Probe Libriray (UPL) probes were designed using ProbeFinder software (v1.5.1, Roche Applied Software, Penzberg, Germany) (Table S3 ). cDNAs, primers, probe, and LightCycler® TaqMan® Master mix were mixed in a final volume of 10 μL and PCR-amplified in a LightCycler® 480 Instrument II (Roche) according to the manufacturer’s instructions. The Ct means of human GAPDH, ACTB, and RPL13A genes were used as endogenous control to normalise the expression of target genes. Each reaction condition was performed in triplicate. Relative gene expression was evaluated by the ΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!