Gibson cloning kit

Manufactured by New England Biolabs

Sourced in Australia, United Kingdom

The Gibson cloning kit is a molecular biology tool used for the assembly of DNA fragments. It enables the seamless joining of multiple DNA segments in a single, isothermal reaction. The kit includes reagents and protocols for performing the Gibson assembly method.

Automatically generated - may contain errors

Lab products found in correlation

Mmessage mmachine t7 kit, by Thermo Fisher Scientific (2 mentions) Pcr cleanup kit, by New England Biolabs (1 mentions) Gel purification kit, by New England Biolabs (1 mentions) Plvx tetone puro, by Takara Bio (1 mentions) Dpni, by Thermo Fisher Scientific (1 mentions) Quikchange lightning 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions) Stbl3 cells, by Thermo Fisher Scientific (1 mentions) Single stranded oligos, by Merck Group (1 mentions) Pacyc184, by New England Biolabs (1 mentions) Monarch gel purification kit, by New England Biolabs (1 mentions) T4 dna ligase, by Promega (1 mentions) Gblocks gene fragment, by Integrated DNA Technologies (1 mentions) Bamhi, by New England Biolabs (1 mentions) Ecori, by Cell Biolabs (1 mentions) Bigdye terminator mix, by Thermo Fisher Scientific (1 mentions) Ecori, by New England Biolabs (1 mentions) Pbabe puro vector, by Cell Biolabs (1 mentions) Pdesttol2pa2 ubi egfp, by Addgene (1 mentions)

Spelling variants of this product

Gibson Assembly Cloning Kit (215 citations) Gibson cloning (30 citations) Gibson DNA assembly/cloning kit (2 citations) NEB Gibson Assembly Cloning Kit (2 citations)

18 protocols using gibson cloning kit

Construction of pSC1a: Inducible gtr6 expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to make pSC1, the gtr6-hyg chimeric cassette was inserted in the middle of the lacZ gene of puc19, where all of the gene except of 5’ end 32 bases, was deleted. However, the gtr6 gene in pSC1 was devoid of its promoter and was not inducible. Additionally, as a small portion of the 5’ end of the lacZ gene remained, the gtr6 gene could not be induced by the lac promoter either. Hence, we decided to delete the 5’ end fragment of lacZ from the gtr6 upstream region and clone the 192 base pair long indigenous promoter region of gtr6 upstream of the gene itself thus creating pSC1a. The plasmid pSC1 (S2E Fig) and the gtr6 indigenous promoter sequence (192 bp) were PCR amplified (S3 Text). The linearized plasmid PCR product was purified with NEB PCR clean up kit using manufacturer’s protocol while the promoter region PCR product was gel purified by NEB Gel purification kit following manufacturer’s protocol. The linear fragments were subjected to Gibson cloning using NEB Gibson Cloning kit following manufacturer’s protocol and was transformed in to NEB 5α Competent E. coli cells. The recombinant clones were selected on LB Hygromycin (150μg/mL) agar plates. Putative clones were grown overnight in 5mL LB Hygromycin (150μg/mL) broth and 1uL was used to perform colony PCR with primers Gtr6-Hyg Internal 5&3 as described previously.

Talyansky Y., Nielsen T.B., Yan J., Carlino-Macdonald U., Di Venanzio G., Chakravorty S., Ulhaq A., Feldman M.F., Russo T.A., Vinogradov E., Luna B., Wright M.S., Adams M.D, & Spellberg B. (2021). Capsule carbohydrate structure determines virulence in Acinetobacter baumannii. PLoS Pathogens, 17(2), e1009291.

+ Open protocol

+ Expand

Plasmid Construction and Cell Line Generation

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

pMRXIP GFP-STX17 (Itakura et al., 2012b (link); plasmid 45909; Addgene) and pCold-TF-hPLEKHM1 (Tabata et al., 2010 (link); plasmid 64146; Addgene) were gifts from N. Mizushima (The University of Tokyo, Tokyo, Japan) and T. Yoshimori (Osaka University, Osaka, Japan), respectively. The following plasmids were generated by ligating open reading frames amplified by PCR into linearized pMX-IRES-YFP (a gift from G. Dewson, The Walter and Eliza Hall Institute of Medical Research, Melbourne, Victoria, Australia), pBMNZ, and pLVX-Tetone-puro (Takara Bio Inc.) using the Gibson Cloning kit (New England Biolabs, Inc.) according to the manufacturer’s instructions: pMX; -LC3A, -LC3B, -LC3C, -GABARAPL1, -HA-GABARAPL1, -GABARAPL2, -HA-GABARAPL2, pBMN; -GABARAP, -PLEKHM1-HA, and pLVX-Tetone-puro; -HA-LC3C, -HA-GABARAPL1. All constructs were sequence verified. The GFP-tagged plasmids of pBMN-mEGFP, -OPTN, -NDP52, -LC3s and -GBRPs, -DFCP1, -WIPI1, -ULK1, and pBMN-mCherry-Parkin and pBMN-YFP-Parkin were described previously (Lazarou et al., 2015 (link)). Stably transfected cell lines were generated using retroviral (for pBMN and pMX-IRES-YFP constructs) and lentiviral (for pLVX-Tetone-puro) systems as described previously (Lazarou et al., 2015 (link)), and protein expression levels were equalized among cell lines by FACS.

Nguyen T.N., Padman B.S., Usher J., Oorschot V., Ramm G, & Lazarou M. (2016). Atg8 family LC3/GABARAP proteins are crucial for autophagosome–lysosome fusion but not autophagosome formation during PINK1/Parkin mitophagy and starvation. The Journal of Cell Biology, 215(6), 857-874.

+ Open protocol

+ Expand

Construction of Suicide Vector pLVC18L-Npt2-SacB/R-recA

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The suicide vector pLVC18L (Zhao et al., 2011 (link)) was modified by insertion of the SacB/R and the ccdB gene cassettes. The Npt2 promoter-SacB/R fragment was amplified through overlap PCR from pEG101-SacB/R and pDSK519-GFP (Matthysse et al., 1996 (link); Traore and Zhao, 2011 (link)) using primers: 1846pLvc18 XbaNpt2 Infusion For1, 5′-TGC CATTGCTGCAGGTCGACTCTAGAGATATCACATGGCGATAGCTAGACT G-3′; 1777Npt2Pro_SacB/R Rv Rev1, 5′-GTG ATGGGTTAAAAAGGATCGATCCGCGCCATCAGATCC TTG-3′; 1778Npt2Pro_SacB/R Rv For2, 5′-CAA GGATCTGATGGCGCGGATCGATCCTTTTTAACCCAT CAC-3′; 1847pLvc18 XbaSacB Infusion Rev2, 5′-CTC GGTACCCGGGGATCCTCTAGAGATATCTTATTTGTTAACTGTTAATTG TCCT-3′.
The PCR product was cloned into the XhoI site of pLVC18L using a Gibson cloning kit (New England BioLabs Inc., Ipswich, MA). The derived construct was designated as pLVC18L-Npt2-SacB/R. A ccdB gene cassette (frame B) (Invitrogen) was further cloned into the SmaI site of pLVC18L-Npt2-SacB/R to generate pLVC18L-Npt2-SacB/R-DesB. The recA gene fragment from TopoEntr-recA was subcloned into pLVC18L-Npt2-SacB/R-DesB using a Gateway®; LR cloning kit (Invitrogen) following the instructions of the user manual. The derived plasmid construct was named pLVC18L-Npt2-SacB/R-recA, and has been confirmed by sequencing at the core facility of the Virginia Bioinformatics Institute (Blacksburg, VA).

Liu Y., Miao J., Traore S., Kong D., Liu Y., Zhang X., Nimchuk Z.L., Liu Z, & Zhao B. (2016). SacB-SacR Gene Cassette As the Negative Selection Marker to Suppress Agrobacterium Overgrowth in Agrobacterium-Mediated Plant Transformation. Frontiers in Molecular Biosciences, 3, 70.

+ Open protocol

+ Expand

Molecular Cloning and Mutagenesis of wcbL

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length wcbL from B. pseudomallei strain K96423 (gift of Rick Titball, University of Exeter) was cloned into the pNIC28-Bsa4 expression vector using ligation-independent cloning (Savitsky et al., 2010 (link)).
The wcbL-pNIC28 construct was used for site-directed mutagenesis using the QuikChange Lightning II site-directed mutagenesis kit (Agilent). Primers (Life Technologies) were designed using the primer design tool available at http://www.genomics.agilent.com/primerDesignProgram.jsp. All mutants were verified by sequencing.
Constructs for expression in B. pseudomallei were prepared by PCR amplifying the wild-type and site-directed mutants of wcbL with extensions that provided a ribosome binding site for Burkholderia, and sequence synonymous with the multiple cloning site of pBBR1-MCS2 (Kovach et al., 1995 (link)). The pBBR1-MCS2 plasmid was also amplified by PCR. Both PCR products were treated with DpnI (Fermentas) to eliminate remaining original plasmid. The PCR products were gel purified, and the concentration determined using a Nanodrop ND2000c spectrophotometer. Plasmid and insert were mixed in a 1:3 M ratio, and cloned using the Gibson cloning kit (NEB) using the manufacturer's recommendations. All successful constructs were verified by sequencing.

Vivoli M., Isupov M.N., Nicholas R., Hill A., Scott A.E., Kosma P., Prior J.L, & Harmer N.J. (2015). Unraveling the B. pseudomallei Heptokinase WcbL: From Structure to Drug Discovery. Chemistry & Biology, 22(12), 1622-1632.

+ Open protocol

+ Expand

Cloning Pcdhγc4-EGFP Fusion Construct

Check if the same lab product or an alternative is used in the 5 most similar protocols

All lentiviral plasmids were cloned from the backbone construct pLenti-CAG-ires-EGFP (addgene plasmid #122953). A Kozak sequence was added at the start of the coding region for all genes cloned. Plasmids were cloned using the Gibson Cloning Kit (NEB). The pLenti-CAG-EGFP construct was cloned by removing the ires sequence in between the BxtXI and BamHI restriction sites from the backbone construct. To clone the pLenti-CAG-Pcdhγc4-EGFP (fusion construct), the pLenti-CAG-ires-EGFP plasmid was digested with BamHI and BstXI to remove the IRES sequence. A PCR generated Pcdhγc4 coding sequence lacking the stop codon and containing a two amino acid (Ser, Arg) linker was cloned upstream of the GFP coding sequence. This construct was used to express Pcdhγc4 fused to GFP.

Leon W.R., Steffen D.M., Dale-Huang F., Rakela B., Breevoort A., Romero-Rodriguez R., Hasenstaub A.R., Stryker M.P., Weiner J.A, & Alvarez-Buylla A. (2023). The Clustered Gamma Protocadherin Pcdhγc4 Isoform Regulates Cortical Interneuron Programmed Cell Death in the Mouse Cortex. bioRxiv.

+ Open protocol

+ Expand

Cloning CRISPR Lentiviral Guides

Check if the same lab product or an alternative is used in the 5 most similar protocols

LentiGuide-Puro was digested with BsmBI and purified by gel extraction (Macherey-Nagel). Single stranded oligos (Sigma) containing the guide sequence and 25nt overlap with digested LentiGuide-Puro on each side (Supplementary Table 1) were cloned with the Gibson cloning kit (NEB). Chemo-competent Stbl3 cells (Thermofisher) were transformed with the Gibson products by heat shock. Upon minipreps (Macherey-Nagel), the plasmids were verified by Sanger sequencing (ABI).

de Rooij M.F., Thus Y.J., Swier N., Beijersbergen R.L., Pals S.T, & Spaargaren M. (2022). A loss-of-adhesion CRISPR-Cas9 screening platform to identify cell adhesion-regulatory proteins and signaling pathways. Nature Communications, 13, 2136.

+ Open protocol

+ Expand

Gibson Cloning of 6K1:GFP and P19 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 6K1:GFP constructs and its derivatives were produced using the Gibson cloning kit (New England Biolabs, Ipswich, UK) following the manufacturer’s instructions. Briefly, compatible gene-specific Gibson primers were designed to perform PCR and the PCR product and the digested pMDC32 vector were joined using Gibson assembly. To clone 6K1 and GFP into pMDC32 plasmid, p35:TuMV/GFP [22 (link)] was used as a template to amplify 6K1 and GFP separately. pMDC32:6K1, pMDC32:6K1:GFP, and pMDC32:GFP were then assembled as above using the Gibson kit. P19 from Tomato bushy stunt virus was cloned into pMDC32 through Gibson assembly [34 (link)].

Bera S., Arena G.D., Ray S., Flannigan S, & Casteel C.L. (2022). The Potyviral Protein 6K1 Reduces Plant Proteases Activity during Turnip mosaic virus Infection. Viruses, 14(6), 1341.

+ Open protocol

+ Expand

Lefty and Gdf1/3-like Intergenic Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The intergenic region between Gdf1/3-like and Lefty was cloned into the pmini-Chordin-mCherry (Shi et al., 2018 (link)) by replacing its Chordin promoter with the intergenic region. The generated pmini-Lefty-mCherry construct was used to generate Lefty::mCherry transgenic amphioxus with method reported previously (Shi et al., 2018 (link)). The intergenic region, the coding sequence of mCherry and eGFP sequence were linked into the pminiTol2 plasmid with a Gibson cloning kit (New England Biolabs) to generate pmini-eGFP-Lefty-Gdf1/3-like-mCherry construct. The later was injected into amphioxus embryos. The injected embryos were treated, with 0.2% dimethyl sulfoxide (as control) or 50 μM SB505124, from 4-cell stage to G1 stage.

Shi C., Chen S., Liu H., Pan R., Li S., Wang Y., Wu X., Li J., Li X., Xing C., Liu X., Wang Y., Qu Q, & Li G. (2024). Evolution of the gene regulatory network of body axis by enhancer hijacking in amphioxus. eLife, 13, e89615.

+ Open protocol

+ Expand

EHEC and C. rodentium Isogenic Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Construction of isogenic ΔcpxA and ΔcpxR in EHEC and C. rodentium was performed using lambda-red mutagenesis as previously described (Datsenko and Wanner, 2000 (link)). The primers used to construct mutations are described in Supplementary Table 2. Briefly, a PCR product was generated using primers containing homologous regions to sequences flanking cpxA and cpxR genes to amplify a kanamycin resistant gene from pKD4. EHEC cells harboring pKD46 were electroporated using the PCR product and colonies were selected from kanamycin LB plates. Nonpolar mutants were generated using resolvases contained into a pCP20 plasmid to cleave off the kanamycin-gene. Complementation experiments were conducted using PCR products flanked with cloned into pACYC184 (NEB) were used as backbones for complementation vectors created with the Gibson cloning kit (NEB).

Kumar A., Russell R., Pifer R., Menezes-Garcia Z., Cuesta S., Narayanan S., MacMillan J.B, & Sperandio V. (2020). The serotonin neurotransmitter modulates virulence of enteric pathogens. Cell host & microbe, 28(1), 41-53.e8.

+ Open protocol

+ Expand

Generation of Cas12a Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate the Cas12a locus for heterologous expression, the Cas12a-type DNA sequences after codon optimization was PCR amplified and cloned into pSC101, pX2, pMINR^{65 (link)}, and pY094 using Gibson cloning kit (New England Biolabs). Sequences of all the chimera and gRNA design can be found in Supplementary Data 1.

Liu R.M., Liang L.L., Freed E., Chang H., Oh E., Liu Z.Y., Garst A., Eckert C.A, & Gill R.T. (2019). Synthetic chimeric nucleases function for efficient genome editing. Nature Communications, 10, 5524.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!