Total RNA was extracted using miRNeasy (Qiagen), treated with the RNase-free DNase set (Qiagen), and quantified on Nanodrop. RIN was assessed on an Agilent Bioanalyzer and was routinely above 8. RNA samples (3 μg) were separated on a 7 m urea denaturing 8% PAGE and transferred to positively charged nylon transfer membranes (GE Healthcare). The resulting blots were hybridized with 32P-5′ end–labeled probes detecting BC200 RNA, tRNA–Ala–TGC, tRNA–Lys–TTT, tRNA–Leu–CAA and 5.8S rRNA in ExpressHyb hybridization solution (TaKaRa). All probes used are indicated in Table S10 and are complementary to the last 24 nucleotides in 3′ of mature tRNAs, including the CCA trinucleotide. 5.8S rRNA was used for normalization of BC200 RNA and tRNA levels.
Expresshyb hybridization solution
Manufactured by Takara Bio
Sourced in United States
ExpressHyb hybridization solution is a pre-made hybridization buffer designed for rapid and efficient hybridization of nucleic acid probes to target sequences. It is a ready-to-use solution that simplifies the hybridization process by eliminating the need for buffer preparation.
Automatically generated - may contain errors
Lab products found in correlation
Hybond n membrane, by GE Healthcare (4 mentions)
Hybond n, by GE Healthcare (3 mentions)
Hybond n membrane, by Cytiva (3 mentions)
Amershan typhoon scanner, by GE Healthcare (2 mentions)
Trans blot sd, by Bio-Rad (2 mentions)
Imagequant tl software, by GE Healthcare (2 mentions)
Zeta probe blotting membrane, by Bio-Rad (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Blot stain blue, by Merck Group (2 mentions)
Typhoon phosphorimager, by GE Healthcare (2 mentions)
Typhoon fla 7000 phosphorimager, by GE Healthcare (2 mentions)
Storage phosphor screen, by GE Healthcare (2 mentions)
Typhoon biomolecular imager, by GE Healthcare (2 mentions)
Amersham hybond n membrane, by GE Healthcare (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Rnase free dnase set, by Qiagen (1 mentions)
Bioanalyzer, by Agilent Technologies (1 mentions)
Mirneasy, by Qiagen (1 mentions)
Hybond xl membrane, by GE Healthcare (1 mentions)
Ladderman labeling kit, by Takara Bio (1 mentions)
27 protocols using expresshyb hybridization solution
1
Northern Blot Analysis of tRNAs and BC200 RNA
2
Southern Blot Analysis of Rosa26 Locus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Southern blotting for correct integration of the targeting construct into the Rosa26 locus was done as described [24 (link)]. Briefly, genomic DNA was isolated from tails and 10 μg were digested with EcoRI. DNA fragments were separated on a 0.7 % agarose gel. The gel was washed two times for 5 min in dH2O, incubated two times for 15 min in 0.125 M HCl for depurination, washed two times for 5 min in H2O, and was finally denatured by incubating two times for 15 min in 0.5 M NaOH/1.5 M NaCl. DNA was blotted over night to a Hybond XL membrane (GE Healthcare). The membrane was then neutralized for 10 min in 0.5 M Tris–HCl pH 7.2/1 M NaCl, dried, and UV-crosslinked by irradiation with 120,000 μJ cm−2. Then, the membrane was pre-incubated for 3 h at 65 °C in ExpressHyb Hybridization Solution (Takara). 25 ng probe was radioactively labeled using Ladderman Labeling Kit (Takara) by adding 25 μCi 32P-dCTP and purified on a Sephadex-G50 column (GE Healthcare). The probe was first denatured and then incubated with the membrane over night at 65 °C. Next, the membrane was briefly washed twice in 2 × SSC/1 % SDS, then incubated in 2 × SSC / 1 % SDS for 30 min, then incubated in 1 × SSC / 1 % SDS for 30 min, followed by 0.5 × SSC / 1 % SDS for 30 min, all at 65 °C. The membrane was used to expose an X-ray film at −80 °C in the dark for 3 to 7 days.
3
Southern Blot Analysis of Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 5-μg aliquots of genomic DNA were digested with EcoRV, PvuII, and SacI, and resolved on a 0.7% agarose gel. 32P-labeled DNA probes were made by PCR using Ex Taq polymerase (Takara) and [alpha-32P] dATP (Perkin Elmer) with primers listed in Supplementary Data 1 . Membrane transfer with Hybond-N+ (GE Healthcare), ultraviolet cross-linking (120 mJ cm−2), pre-hybridization and hybridization were performed according to the instructions for ExpressHyb Hybridization Solution (Takara). The radio-isotope signal was detected using a bioimaging analyzer BAS-2500 (Fujifilm).
4
Northern Blot for RNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blot was performed similarly as before72 (link),73 (link). Briefly, 1–5 μg purified total RNA or 5 pmole synthetic RNA oligos were resolved on 15% Novex TBE-Urea gel (Invitrogen #EC6885BOX) and transferred to Amersham Hybond-N + nylon membrane (Cytiva #RPN203B) by Trans-Blot SD semi-dry transfer apparatus (Bio-Rad). The membrane was cross-linked with 254 nm wavelength by Stratalinker (Strategene).
For Northern blot: After UV crosslinking, the membrane was blocked by ExpressHyb Hybridization Solution (Takara Bio #636833) and probed with biotinylated DNA probe (probe sequences see Supplementary Table7 ) following the manufacturer’s instructions. Notably, the upper (U6 and full-length tRNA) and lower (tRF) parts of the membrane was cut after transfer, probed, and developed separately to avoid saturation of tRNA signals. Hybridized membrane was detected with Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Fisher #89880).
For immuno-Northern blot: After UV crosslinking, the membrane was blocked with 3% milk in PBST and detected by m1A primary antibody (MBL #D3453, used at 1:2000 dilution) followed by anti-mouse HRP-linked secondary antibody (Cell Signaling #7076, used at 1:5000 dilution). Chemiluminescence detection was performed with Immobilon HRP substrate (Millipore #WBKLS0500). Oligo size was compared to microRNA marker (NEB #N2102S) on the gel.
For Northern blot: After UV crosslinking, the membrane was blocked by ExpressHyb Hybridization Solution (Takara Bio #636833) and probed with biotinylated DNA probe (probe sequences see Supplementary Table
For immuno-Northern blot: After UV crosslinking, the membrane was blocked with 3% milk in PBST and detected by m1A primary antibody (MBL #D3453, used at 1:2000 dilution) followed by anti-mouse HRP-linked secondary antibody (Cell Signaling #7076, used at 1:5000 dilution). Chemiluminescence detection was performed with Immobilon HRP substrate (Millipore #WBKLS0500). Oligo size was compared to microRNA marker (NEB #N2102S) on the gel.
5
Quantifying Mitochondrial tRNAs and tiRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mitochondrial tyrosine tRNA (mt‐Ty) tRNAs and mt‐Ty 5'tiRNAs in skeletal muscle of 2mo mice were determined by near‐infrared fluorescent northern blot.17 Briefly, 10–20 μg of total RNA from each sample was separated on 15% Urea‐PAGE gel and transferred to Hybond N+ membrane (GE). The membrane was crosslinked twice using a 254 nm UV crosslinker at 120 mJ/cm2, which was followed by incubation with ExpressHyb hybridization solution (Takara) for 30 min at 30°C. The membrane was then hybridized overnight at 30°C with IR‐dye conjugated probes (Table S1 ). To conjugate the probes with IR‐dye, 2.5 nmol oligos were combined with 50 nmol IRDye 680RD (Li‐Cor, catalogue number: 929‐50005) or 800CW DBCO (Li‐Cor, catalogue number: 929‐55000) in PBS with a reaction volume of 50 μl, then incubated at room temperature in the dark for 6 h. After incubation, 2 volumes of AMPure XP beads (Beckman Coulter, catalogue number: A63881) and 5.4 volumes of isopropanol were mixed with the reaction to purify the IR‐dye conjugated probes. The membrane was washed twice with 1X SSC‐0.1% SDS buffer at room temperature on the following day and scanned on an Amershan Typhoon scanner (GE health) to detect emission at 600 nm and 800 nm.
6
Detecting RNA Targets via Northern Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blot analyses were performed using near infrared dye-labeled probes as previously described (35 (link), 36 (link)). Briefly, 15 µg of total RNA from either UM-SCC-10A or UM-SCC-12 was separated using 15% Urea-PAGE and contents were subsequently transferred to Hybond N+ membrane (GE) using LifeTech transfer module at 0.2 Amp for one hour. The membrane was crosslinked twice using 254nm UV crosslinker at 120 mJ/cm2. The membrane was then placed in a hybridization oven and incubated with 10ml ExpressHyb hybridization solution (Takara) in a hybridization tube for 30 minutes at 30°C. IR-dye labeled probes and the membrane were then hybridized overnight at 30°C. After overnight hybridization, the membrane was washed twice, with 2x SSC buffer containing 0.1% SDS and 1x SSC buffer containing 0.1% SDS, respectively. For both washes, membrane was shaken at 110 rpm for 10 minutes at room temperature. Following washes, membrane was scanned on Amershan Typhoon scanner (GE health) to detect emission at 600 nm and 800 nm.
7
miRNA Detection and Analysis
8
Krebs Extract RNA Translation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Untreated or RNase-treated Krebs extracts were incubated with Luc or N1mΨ–Luc mRNAs (4 μg/ml) at 30°C. At the indicated times, 12.5 μl aliquots of the reaction mixtures were withdrawn and the translation was stopped by the addition of SDS-proteinase K solution (20 (link)). Following incubation for 15 min at room temperature, total RNA was extracted with phenol–chloroform and precipitated with ethanol. RNA was separated on formaldehyde-1% agarose gels and transferred onto nylon membranes (Hybond-N, GE Healthcare). To confirm equal RNA loading, the blots were stained with Blot Stain Blue (Sigma) and the intensities of bands of 18S ribosomal RNA (rRNA) were measured using NIH Image J. software. RNA was then hybridized with ∼300 bp-long fragment of randomly primed 32P-labeled luc cDNA using ExpressHyb hybridization solution (Clontech Laboratories, Inc), as described by the manufacturer. The blots were exposed to X-ray films. Bands of Luc mRNA were quantified using a Typhoon PhosphorImager (GE Healthcare).
9
Northern Blot RNA Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared in the same way as for the EMOTE assay, but with an additional step of ethanol precipitation to concentrate the RNA. 4 µg total RNA from each strain was loaded on a 5% polyacryl amide gel with 8M urea, and afterwards transferred to a Hybond-N nitrocellulose membrane (Amersham) using a Biorad Protean Tetra-cell blotting system. The RNA was crosslinked to the membrane with a UV Stratalinker 2400 (Stratagene), and the marker was revealed using Methylene blue. Probes were hybridised over night at 37°C in ExpressHyb hybridization solution (Clontech, Mountain View, CA, USA), excess probe was washed away, and the signal was detected using a Typhoon FLA 7000 phosphorimager (General Electric). The membrane was stripped for 2 hours at 75°C with 0.2% SDS and 10 mM Tris pH 7.5, whereupon a new probe was hybridised. Loading control was done with a 5S rRNA probe, used last to ensure that the strong 5S signal did not interfere with the other experiments. Probes used for Northern blotting (Table S9 ) were 5′ labelled using 32P γ-ATP and T4 polynucleotide kinase (New England Biolabs).
10
Quantifying miRNA Expression by Northern Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blot analysis was performed on the basis of the method that has been previously described, with some modifications (64 (link)). Twenty micrograms of total RNA was separated on 15% tris-borate EDTA (TBE)–urea gels (Bio-Rad, #4566055) and then transferred to a positively charged nylon membrane (Roche, #11209299001). The membrane was cross-linked twice with 254 nm of UV light at 120 mJ/cm2 using a CL-1000 UV cross-linker. After prehybridization with 10 ml of ExpressHyb hybridization solution (Clontech) for 40 min at 37°C, the membrane was hybridized overnight with 15 pmol of IRDye-labeled oligonucleotide probes [hsa-miR-17-5p (/5IRD700/ctacctgcactgtaagcactttg), hsa-let-7d-5p (/5IRD700/aactatgcaacctactacctct), RNU43 (/5IRD800/CAGCACACAGTTTCTGTCCGCCCGTC), and RNA5S1 (/5IRD800/cccaggcggtctcccatccaagtactaaccaggcccgaccc)] in 10 ml of ExpressHyb solution at 37°C. The membrane was washed twice with 2× SSC and 0.1% SDS and once with 1× SSC and 0.1% SDS (10 min at room temperature for each) and visualized using the Odyssey CLx Imaging System followed by quantification using Image Studio software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!