Dnase buffer

For RT-PCR, mRNA was isolated from 200μg yeast total RNA prepared by the hot phenol method [77 (link)] with the SIGMA GenElute mRNA Miniprep kit according to the manufacturers protocol and eluted in 100μl of elution buffer. The polyadenylated mRNA sample was treated with 10 units of RQ1 DNase (Promega) in 1X DNase Buffer (Promega) and 200 units RNasin (Promega) at 30°C for 30 minutes. The reaction was then stopped by adding 2mM of EDTA and incubation at 65°C for 10 minutes. An equal amount of citrate buffered phenol (pH 5.3) was added followed by vortexing for 1 minute and centrifugation at 15600g for 2 minutes. The polyadenylated mRNA was then precipitated from the aqueous phase by adding 0.1 volume of 3M sodium acetate (pH 5.3), 2.5 volumes of 100% ethanol and 10μg of glycogen. The sample was precipitated at -20°C for 30 minutes. The RNA was collected by centrifugation for 5 minutes and washed with 96% ethanol, pelleted again at 15600g and air dried. The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). The procedure for cDNA synthesis and PCR amplification was based on the manufacturer’s instructions. Primers for primer walking of the SEC4 and TUB2 coding sequence and 3’ UTR are listed in S18 Table.

For Figure 5E, total RNA was extracted from cells using QIAshredder and RNeasy kits (Qiagen). To remove any DNA, the extracts were incubated with DNAse buffer (Promega) and residual DNAse was subsequently inactivated with DNAse stop solution (Promega). cDNA synthesis was performed using LunaScript RT SuperMix Kit (NEB). Polymerase chain reactions were carried out using TaqMan 2× Universal PCR Master Mix or SYBR Green PCR Master Mix (Thermo) on a QuantStudio™ 7 Flex Real-Time PCR System (Thermo). Acidic ribosomal phosphoprotein P0 (36B4), β-actin (b-act) and 18S ribosomal RNA (18s) were used as internal controls. The following primer sets were used: 36B4_F; AGATGCAGCAGATCCGCAT and 36B4_R; GTTCTTGCCCATCAGCACC, b-act_F; GCTCTGGCTCCTAGCACCAT and b-act_R; GCCACCGATCCACACAGAGT, and 18s_F; CGGCTACCACATCCAAGGAA and 18s_R; GCTGGAATTACCGCGGCT, with the corresponding 18s taqman probe GAGGGCAAGTCTGGTGCCAG. The TaqMan gene expression assay (premixed primer set and probes) was used for murine Trarg1 (Mm03992124_m1).

Mice were transcardially perfused with PBS, brains harvested, and a 2-mm-thick tissue slice (− 1.0 to − 3.0 mm relative to bregma) was prepared from each brain and separated into the left and right hemispheres. Total RNA from brain tissue samples or cells was isolated using the TRI reagent (Thermo Fisher Scientific, Dreieich, Germany) according to manufacturer’s instructions. For digestion of residual DNA, 10 μg of total RNA was incubated in a 25 μl reaction mix containing 1x DNase-buffer, 40 U RNasin and 1 U DNase (Promega, Mannheim, Germany) for 30 min at 37 °C. Subsequently, cDNA was synthesized using the Access Reverse Transcription PCR Kit (Promega, #A1260) and quantitative real-time PCR for the target sequences was performed in the Rotor-Gene Q (Qiagen, Hilden, Germany) using the QuantiTect SYBR Green PCR Kit (Qiagen). Fluorescence was monitored (excitation at 470 nm and emission at 530 nm) at the end of the annealing phase. Threshold cycle (Ct) was set within the exponential phase of the PCR. Quantification of the PCR product was done by using the ΔΔCt method. Amplification of the 40S ribosomal protein S12 (Rps12) cDNA served as an internal standard. Primers were purchased from Eurofins Genomics (for primer sequences, see Additional file 2: Table S4).

All bacterial
experiments used the Pseudomonas strain Pse1.^{40 (link),41 (link)} Cells were cultured for 48 h at 20 °C in 100 mL of the LB medium
with shaking at 150 rpm until the mid-late exponential phase. DNA
in the growth medium was determined by the fluorescence assay (Quantifluor,
Promega Ltd., UK).
Cells were centrifuged at 6250g_n for 20 min and resuspended in one-fifth of the original
growth medium. For DNaseI treatment, 10× DNase buffer (Promega)
was added to a final concentration of 0.1× and then DNaseI was
added at 15 U mL^–1. The sample was mixed by inversion
and incubated at 20 °C for 30 min with occasional gentle mixing.
To test the efficiency of the DNaseI treatment, 100 μL of the
sample was withdrawn at the start of the assay and bacterial cells
were removed by centrifugation at 16,000g_n for 10 min. The supernatant (19 μL) was mixed with 1 μL
of 25 ng μL^–1 phage lambda DNA (Thermo Fisher
Scientific) and incubated as above. Digestion was checked by electrophoresis
through 1% agarose gel using undigested lambda DNA as a control. DNase
was removed by washing the cells a further two times in a phosphate
buffered saline (PBS) medium, which was prepared following a standard
protocol (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, and 1.8 mM KH₂PO₄).