The ZIKV strain Rio-U1 (GenBank accession number: KU926309 ) was isolated in Rio de Janeiro, Brazil, in 2016 from a human patient’s urine sample (Bonaldo et al., 2016 (link)). The ZIKV cDNA was synthesized in four fragments (GenScript). Fragments Z1, Z2, and Z4 were cloned into a high-copy plasmid pUC57 while fragment Z3 was cloned into a derivative of the low-copy plasmid pCC1-Fos (Epicenter). pCC1 is based on a previously developed technology (Carson et al., 1973 (link)). It is a single copy plasmid usually under control of the E. coli F factor single-copy origin of replication. But in the presence of an inductor (L -arabinose) the initiation of replication from high-copy oriV origin occurs, which requires the trfA gene product supplied by the E. coli cells. All fragments encompassed the entire genome of the ZIKV Rio-U1, with overlapping regions at their ends. To ensure a seamless assembly of the full-length cDNA, we engineered silent mutations to introduce restriction cleavage sites at both ends of each synthetic fragment.
Pcc1fos
Manufactured by Illumina
Sourced in United States
PCC1FOS is a laboratory instrument designed for the purification and concentration of DNA samples. It utilizes a flow cell-based technology to perform size-selective separation and enrichment of target DNA molecules from complex samples. The core function of PCC1FOS is to provide a streamlined and automated solution for DNA sample preparation, enabling efficient and reproducible results for downstream analysis.
Automatically generated - may contain errors
Lab products found in correlation
Taq dna polymerase, by Takara Bio (1 mentions)
Restriction endonuclease, by Takara Bio (1 mentions)
E coli bl21 de3 competent cell, by Transgene (1 mentions)
Ni nta agarose resin, by Qiagen (1 mentions)
In fusion hd cloning kit, by Takara Bio (1 mentions)
E coli epi300, by Illumina (1 mentions)
Pcold 1, by Takara Bio (1 mentions)
P nitrophenyl laurate, by Merck Group (1 mentions)
Tributyrin, by Merck Group (1 mentions)
P nitrophenyl palmitate, by Merck Group (1 mentions)
P nitrophenyl butyrate, by Merck Group (1 mentions)
P nitrophenyl caproate, by Merck Group (1 mentions)
P nitrophenyl caprylate, by Merck Group (1 mentions)
P nitrophenyl caprate, by Merck Group (1 mentions)
P nitrophenyl myristate, by Merck Group (1 mentions)
P nitrophenyl acetate, by Merck Group (1 mentions)
Pcoldi plasmid vector, by Takara Bio (1 mentions)
Oligonucleotide primers, by Bioneer (1 mentions)
Bl21 de3, by Thermo Fisher Scientific (1 mentions)
Epi300 t1r, by Illumina (1 mentions)
11 protocols using pcc1fos
1
Synthesis of Full-Length ZIKV Rio-U1 cDNA
2
Cloning and Characterization of Glycosidases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Taq DNA polymerase, restriction endonucleases, and PCR reagents were obtained from Takara (Beijing, China). In-Fusion HD Cloning Kit (Takara Beijing, China), plasmid pEASY-E2, and E. coli BL21(DE3) competent cells (TransGen, Beijing, China) were adopted in the cloning process. The purification was performed with Ni-NTA Agarose resin (Qiagen, Hilden, Germany). p-Nitrophenyl-α-D -glucopyranoside (pNPG), p-nitrophenyl-β-D -galactopyranoside, p-nitrophenyl-β-D -glucopyranoside, p-nitrophenyl-α-D -mannopyranoside, and 2-nitrophenyl-β-D -glucopyranoside were supplied by Shanghai Yuanye Bio-Technology (China). The vector pCC1FOS and E. coli EPI300 were purchased from Epicentre. The remaining chemicals reagents were of analytical grade except for those specified. The cultivation environment of the strains E. coli is at 37°C in the Luria–Bertani (LB) liquid medium, in which the salt concentrations can reach their final stages, encompassing the salt showed in the normal LB medium. In order to select certain plasmids, 12.5 μg/ml chloramphenicol (Cm) or ampicillin (100 μg/ml) was used as an alternative of the medium. Previously constructed fecal microbial metagenomic libraries of N. pygmaeus and B. frontalis were used (Xu et al., 2014 (link); Dong et al., 2016 (link)).
3
Construction of Fosmid Library for Biosynthetic Gene Cluster
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the construction of the fosmid library high-molecular-weight genomic DNA from A. atramentaria was prepared according to standard protocols. The DNA was sheared to ~40-kb fragments and cloned into pCC1FOS (Epicentre Biotechnologies). A library with ~1000 clones was generated in E. coli EPI300 according to the manufacturer's instructions. To identify fosmids containing the putative BGC, the library was screened by PCR with primer pair mat_f CTGGTCATGAAGAGACTCGC/mat_r CAGCGACGTGATGTCCTTCG. The primer pair was designed to amplify a 0.6 kb fragment within matG. Positive fosmids were characterized by restriction analysis and end-sequencing.
4
Construction of Metagenomic Library from Empetrum nigrum Endophytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
EPI-300™-T1® Phage T1-resistant E. coli cultures were grown at 37° C. on Luria-Bertani (LB) agar or in LB broth+10 mM MgSO4 supplemented with the appropriate antibiotics. The following antibiotic concentrations were used for the E. coli strain: chloramphenicol 12.5 μg ml−1 and ampicillin 100 μg ml−1. Plasmid pCC1FOS™ (Epicentre, Madison, USA) that carries two origins of replication, a single copy origin (ori2) and an inducible high copy origin (oriV) was used to construct the metagenomic library from endophytes of Empetrum nigrum and for subcloning the genes conferring such antibacterial activity. The pET11-c vector was used to express the genes responsible for the antibacterial activity in the host strain E. coli BL21 (DE3) gold.
5
Microbial Enzyme Characterization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microbulbifer thermotolerans DAU221 was deposited in the Korean Culture Center of Microorganisms (KCCM 43021, 16S rDNA sequence GenBank ID KC571186 ) and cultured in Marine Broth 2216 (Difco, Detroit, MI, USA). Plasmids pUC118 and pCC1FOS (Epicentre, Madison, USA) were used to construct the genomic library, and pCold I (TaKaRa, Kyoto, Japan) was used as the protein expression vector. Escherichia coli (E. coli) JM109 and EPI300-T1 were used for cloning, and BL21 (DE3) was used for protein expression. E. coli strains were grown at 37°C in Luria-Bertani (LB) broth supplemented with ampicillin (50 μg mL−1) or chloramphenicol (12.5 μg mL−1) when required. Tributyrin, p-nitrophenyl acetate (C2), p-nitrophenyl butyrate (C4), p-nitrophenyl caproate (C6), p-nitrophenyl caprylate (C8), p-nitrophenyl caprate (C10), p-nitrophenyl laurate (C12), p-nitrophenyl myristate (C14), p-nitrophenyl palmitate (C16), and p-nitrophenyl stearate (C18) were purchased from Sigma-Aldrich (USA).
6
Microbulbifer thermotolerans Chitinase Gene Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Microbulbifer thermotolerans DAU221 strain used in this study was deposited in the Korean Culture Center of Microorganisms (KCCM 43021; 16S rDNA sequence GenBank ID: KC571186). It was cultivated in Marine Broth 2216 (MB; Difco, Detroit, MI, USA). Plasmids pUC118 and pCC1FOS (Epicentre, Madison, WI, USA) and Escherichia coli (E. coli) JM109, EPI300-T1 were used to construct the genomic library and cloning the chitinase gene. The pCold I plasmid vector (TaKaRa, Otsu, Japan) and E. coli BL21 (DE3) cells were used for heterologous expression. M. thermotolerans DAU221 was cultured in MB medium with shaking at 30 °C overnight. E. coli JM109 and BL21 (DE3) were grown in Luria–Bertani (LB) broth at 37 °C. Ampicillin (50 μg/mL) or chloramphenicol (12.5 μg/mL) was added to the LB broth when required. Oligonucleotide primers were purchased from Bioneer (Daejeon, South Korea). Chitooligosaccharides—N-acetylglucosamine (NAG1), chitobiose (NAG2), chitotriose (NAG3), chitotetraose (NAG4), chitopentaose (NAG5), and chitohexaose (NAG6)—were purchased from Seikagaku (Tokyo, Japan).
7
Construction of Metagenomic Library from Empetrum nigrum Endophytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
EPI-300™-T1® Phage T1-resistant E. coli cultures were grown at 37° C. on Luria-Bertani (LB) agar or in LB broth+10 mM MgSO4 supplemented with the appropriate antibiotics. The following antibiotic concentrations were used for the E. coli strain: chloramphenicol 12.5 μg ml−1 and ampicillin 100 μg ml−1. Plasmid pCC1FOS™ (Epicentre, Madison, USA) that carries two origins of replication, a single copy origin (ori2) and an inducible high copy origin (oriV) was used to construct the metagenomic library from endophytes of Empetrum nigrum and for subcloning the genes conferring such antibacterial activity. The pET11-c vector was used to express the genes responsible for the antibacterial activity in the host strain E. coli BL21 (DE3) gold.
8
Construction of Metagenomic Lipolytic Gene Library
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli strain EPI300-T1R (Epicenter) was used for the construction of a metagenomic library. E. coli DH5α (Intron biotechnology) and BL21(DE3) (Invitrogen) were used as host strains for subcloning and overexpression of metagenomic gene retaining lipolytic activity, respectively. The pCC1FOS (Epicenter, United States) and pUC19 vectors were used for subcloning of the open reading frame encoding lipolytic activity. The pET22b(+) vector (Novagen) was lastly used for cloning and overexpression.
9
Isolation of Antibacterial Genes from Endophytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
EPI-300™-T1R Phage T1-resistant E. coli cultures were grown at 37° C. on Luria-Bertani (LB) agar or in LB broth+10 mM MgSO4 supplemented with the appropriate antibiotics. The following antibiotic concentrations were used for the E. coli strain: chloramphenicol 12.5 μg ml−1 and ampicillin 100 μg ml−1. Plasmid pCC1FOS™ (Epicentre, Madison, USA) that carries two origins of replication, a single copy origin (ori2) and an inducible high copy origin (oriV) was used to construct the metagenomic library from endophytes of Empetrum nigrum and for subcloning the genes conferring such antibacterial activity. The pET11-c vector was used to express the genes responsible for the antibacterial activity in the host strain E. coli BL21 (DE3) gold.
10
Metagenomic Library Construction and Antibacterial Screening
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
EPI-300™-T1R Phage T1-resistant E. coli cultures were grown at 37° C. on Luria-Bertani (LB) agar or in LB broth+10 mM MgSO4 supplemented with the appropriate antibiotics. The following antibiotic concentrations were used for the E. coli strain: chloramphenicol 12.5 μg ml−1 and ampicillin 100 μg ml−1. Plasmid pCC1FOS™ (Epicentre, Madison, USA) that carries two origins of replication, a single copy origin (ori2) and an inducible high copy origin (oriV) was used to construct the metagenomic library from endophytes of Empetrum nigrum and for subcloning the genes conferring such antibacterial activity. The pET11-c vector was used to express the genes responsible for the antibacterial activity in the host strain E. coli BL21 (DE3) gold.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!